FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630318_at:

>probe:Drosophila_2:1630318_at:480:575; Interrogation_Position=129; Antisense; GGCGCAGCACGAAGTCTATAGCATG
>probe:Drosophila_2:1630318_at:723:605; Interrogation_Position=182; Antisense; TGATCCGCAGCTTGGAGTCCCAGAA
>probe:Drosophila_2:1630318_at:294:365; Interrogation_Position=204; Antisense; GAATATTAAGCGACTGATCCCCATC
>probe:Drosophila_2:1630318_at:155:697; Interrogation_Position=231; Antisense; TTTCGATCGGCGCAAGGAGCTCAAG
>probe:Drosophila_2:1630318_at:510:273; Interrogation_Position=273; Antisense; CTTGGTCAACTTCCTAGATCTCATT
>probe:Drosophila_2:1630318_at:483:403; Interrogation_Position=298; Antisense; GACTTTCTTATCCTGAATCCTGACA
>probe:Drosophila_2:1630318_at:288:457; Interrogation_Position=349; Antisense; GATATCAGTCTGCTGTTCGTCAACA
>probe:Drosophila_2:1630318_at:400:53; Interrogation_Position=373; Antisense; ATGCATCACCTCCTCAATGAATTTC
>probe:Drosophila_2:1630318_at:646:175; Interrogation_Position=416; Antisense; AAACGCTGCGCGTCATGATGGAAAT
>probe:Drosophila_2:1630318_at:170:427; Interrogation_Position=502; Antisense; GAGATCGTTAATACCGCCTTCTCAG
>probe:Drosophila_2:1630318_at:145:119; Interrogation_Position=525; Antisense; AGCTCTGCCGGTTCTAGATGATGAC
>probe:Drosophila_2:1630318_at:221:289; Interrogation_Position=605; Antisense; CGGCGGCCAAGAATGATCCCAGTTA
>probe:Drosophila_2:1630318_at:192:93; Interrogation_Position=625; Antisense; AGTTACCAGCACGATCGCATGTTGT
>probe:Drosophila_2:1630318_at:47:361; Interrogation_Position=650; Antisense; GCAAGCTTGTGGACGCTATCGAGTA

Paste this into a BLAST search page for me
GGCGCAGCACGAAGTCTATAGCATGTGATCCGCAGCTTGGAGTCCCAGAAGAATATTAAGCGACTGATCCCCATCTTTCGATCGGCGCAAGGAGCTCAAGCTTGGTCAACTTCCTAGATCTCATTGACTTTCTTATCCTGAATCCTGACAGATATCAGTCTGCTGTTCGTCAACAATGCATCACCTCCTCAATGAATTTCAAACGCTGCGCGTCATGATGGAAATGAGATCGTTAATACCGCCTTCTCAGAGCTCTGCCGGTTCTAGATGATGACCGGCGGCCAAGAATGATCCCAGTTAAGTTACCAGCACGATCGCATGTTGTGCAAGCTTGTGGACGCTATCGAGTA

Full Affymetrix probeset data:

Annotations for 1630318_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720