Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630320_at:

>probe:Drosophila_2:1630320_at:395:401; Interrogation_Position=361; Antisense; GACATCGCTGTGCTCCATCTGAGCT
>probe:Drosophila_2:1630320_at:629:39; Interrogation_Position=377; Antisense; ATCTGAGCTCCTCTCTGAGCTTCAG
>probe:Drosophila_2:1630320_at:171:531; Interrogation_Position=474; Antisense; GGGTACCGAGTCCTCTGGCTCCAGC
>probe:Drosophila_2:1630320_at:444:633; Interrogation_Position=508; Antisense; TCCCAGCTGCGTTATGTCAACGTGA
>probe:Drosophila_2:1630320_at:567:599; Interrogation_Position=522; Antisense; TGTCAACGTGAACATCGTCAGCCAG
>probe:Drosophila_2:1630320_at:310:187; Interrogation_Position=532; Antisense; AACATCGTCAGCCAGAGCCGGTGCT
>probe:Drosophila_2:1630320_at:130:277; Interrogation_Position=557; Antisense; CTTCTTCCTCCTATGGCTACGGAAA
>probe:Drosophila_2:1630320_at:60:33; Interrogation_Position=586; Antisense; ATCAAGAGCTCCATGATCTGCGCTT
>probe:Drosophila_2:1630320_at:349:213; Interrogation_Position=589; Antisense; AAGAGCTCCATGATCTGCGCTTTTG
>probe:Drosophila_2:1630320_at:460:337; Interrogation_Position=593; Antisense; GCTCCATGATCTGCGCTTTTGCCAG
>probe:Drosophila_2:1630320_at:30:701; Interrogation_Position=609; Antisense; TTTTGCCAGCGGCAAGGACTCGTGC
>probe:Drosophila_2:1630320_at:567:529; Interrogation_Position=693; Antisense; GGGATACGGATGTGCTGCCGCTAAC
>probe:Drosophila_2:1630320_at:716:27; Interrogation_Position=696; Antisense; ATACGGATGTGCTGCCGCTAACTAC
>probe:Drosophila_2:1630320_at:569:505; Interrogation_Position=704; Antisense; GTGCTGCCGCTAACTACCCCGGTGT

Paste this into a BLAST search page for me
GACATCGCTGTGCTCCATCTGAGCTATCTGAGCTCCTCTCTGAGCTTCAGGGGTACCGAGTCCTCTGGCTCCAGCTCCCAGCTGCGTTATGTCAACGTGATGTCAACGTGAACATCGTCAGCCAGAACATCGTCAGCCAGAGCCGGTGCTCTTCTTCCTCCTATGGCTACGGAAAATCAAGAGCTCCATGATCTGCGCTTAAGAGCTCCATGATCTGCGCTTTTGGCTCCATGATCTGCGCTTTTGCCAGTTTTGCCAGCGGCAAGGACTCGTGCGGGATACGGATGTGCTGCCGCTAACATACGGATGTGCTGCCGCTAACTACGTGCTGCCGCTAACTACCCCGGTGT

Full Affymetrix probeset data:

Annotations for 1630320_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime