Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630322_at:

>probe:Drosophila_2:1630322_at:703:241; Interrogation_Position=3544; Antisense; AATTTAACTCTCCAACACGTGTAAT
>probe:Drosophila_2:1630322_at:390:243; Interrogation_Position=3566; Antisense; AATATTATGTTTACCCTCTCACTAA
>probe:Drosophila_2:1630322_at:284:467; Interrogation_Position=3657; Antisense; GTTGCGATCAACTGAGGTCCGGGTA
>probe:Drosophila_2:1630322_at:645:531; Interrogation_Position=3672; Antisense; GGTCCGGGTAACTCCTAACATGATG
>probe:Drosophila_2:1630322_at:235:335; Interrogation_Position=3721; Antisense; GCTCAGTAGAAACGTTTTCGCGCGT
>probe:Drosophila_2:1630322_at:664:633; Interrogation_Position=3738; Antisense; TCGCGCGTTGCGATCCTTGAAGTAG
>probe:Drosophila_2:1630322_at:420:125; Interrogation_Position=3786; Antisense; AGCCGCCACGACAACCACGAAGAGA
>probe:Drosophila_2:1630322_at:609:215; Interrogation_Position=3820; Antisense; AAGATCTTGGCGTTGGACATTCCCG
>probe:Drosophila_2:1630322_at:437:569; Interrogation_Position=3844; Antisense; GGCTTGGGATCTTCTTTGTGCTCGC
>probe:Drosophila_2:1630322_at:329:345; Interrogation_Position=3889; Antisense; GCATTCGGTATGATATTGGAGCGCC
>probe:Drosophila_2:1630322_at:302:727; Interrogation_Position=3904; Antisense; TTGGAGCGCCGGATAATCTCATCGT
>probe:Drosophila_2:1630322_at:507:455; Interrogation_Position=3915; Antisense; GATAATCTCATCGTGCTGCGAACAA
>probe:Drosophila_2:1630322_at:523:179; Interrogation_Position=4050; Antisense; AAACAATGTGTTTAAAGCCAGCTGC
>probe:Drosophila_2:1630322_at:96:205; Interrogation_Position=4064; Antisense; AAGCCAGCTGCTTAATTATTACAAG

Paste this into a BLAST search page for me
AATTTAACTCTCCAACACGTGTAATAATATTATGTTTACCCTCTCACTAAGTTGCGATCAACTGAGGTCCGGGTAGGTCCGGGTAACTCCTAACATGATGGCTCAGTAGAAACGTTTTCGCGCGTTCGCGCGTTGCGATCCTTGAAGTAGAGCCGCCACGACAACCACGAAGAGAAAGATCTTGGCGTTGGACATTCCCGGGCTTGGGATCTTCTTTGTGCTCGCGCATTCGGTATGATATTGGAGCGCCTTGGAGCGCCGGATAATCTCATCGTGATAATCTCATCGTGCTGCGAACAAAAACAATGTGTTTAAAGCCAGCTGCAAGCCAGCTGCTTAATTATTACAAG

Full Affymetrix probeset data:

Annotations for 1630322_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime