FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630323_at:

>probe:Drosophila_2:1630323_at:666:277; Interrogation_Position=222; Antisense; CTAGTGGTCCTACCCAGAGTCTGTT
>probe:Drosophila_2:1630323_at:183:253; Interrogation_Position=250; Antisense; CAACTACTACTACACCAGGGATCCT
>probe:Drosophila_2:1630323_at:299:729; Interrogation_Position=281; Antisense; TTGGTGAAGCCCTTCGTCGACGTGG
>probe:Drosophila_2:1630323_at:77:161; Interrogation_Position=315; Antisense; ACAAGAAGATGCTCACCGCCAAGGT
>probe:Drosophila_2:1630323_at:211:169; Interrogation_Position=361; Antisense; AAAGGCTCAGGCCAAGTCTGGAGAT
>probe:Drosophila_2:1630323_at:622:49; Interrogation_Position=384; Antisense; ATGCGCCGAAAGATGGTAGCCCCAT
>probe:Drosophila_2:1630323_at:401:639; Interrogation_Position=417; Antisense; TCGGGCCCAAGACTACTGATACAAA
>probe:Drosophila_2:1630323_at:83:377; Interrogation_Position=472; Antisense; GAAGCTCCCGACTCCAGGAAAGGTG
>probe:Drosophila_2:1630323_at:53:579; Interrogation_Position=510; Antisense; GGCCACATTAACCTGTTCAATACCC
>probe:Drosophila_2:1630323_at:551:27; Interrogation_Position=529; Antisense; ATACCCTCCTTATTCAGAAACTCTT
>probe:Drosophila_2:1630323_at:10:515; Interrogation_Position=556; Antisense; GTGTTCATTGCTTATTCCATTTCGA
>probe:Drosophila_2:1630323_at:525:231; Interrogation_Position=580; Antisense; AATGCACTTTGCAGGCAGTCGTAAA
>probe:Drosophila_2:1630323_at:543:323; Interrogation_Position=704; Antisense; GCGCAAATCGAGGTCCAACGGGTTT
>probe:Drosophila_2:1630323_at:343:1; Interrogation_Position=717; Antisense; TCCAACGGGTTTGTTACAGGCCACA

Paste this into a BLAST search page for me
CTAGTGGTCCTACCCAGAGTCTGTTCAACTACTACTACACCAGGGATCCTTTGGTGAAGCCCTTCGTCGACGTGGACAAGAAGATGCTCACCGCCAAGGTAAAGGCTCAGGCCAAGTCTGGAGATATGCGCCGAAAGATGGTAGCCCCATTCGGGCCCAAGACTACTGATACAAAGAAGCTCCCGACTCCAGGAAAGGTGGGCCACATTAACCTGTTCAATACCCATACCCTCCTTATTCAGAAACTCTTGTGTTCATTGCTTATTCCATTTCGAAATGCACTTTGCAGGCAGTCGTAAAGCGCAAATCGAGGTCCAACGGGTTTTCCAACGGGTTTGTTACAGGCCACA

Full Affymetrix probeset data:

Annotations for 1630323_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720