FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630326_at:

>probe:Drosophila_2:1630326_at:249:349; Interrogation_Position=165; Antisense; GCAGTGCGCCCAACGGATTTTAGGA
>probe:Drosophila_2:1630326_at:158:77; Interrogation_Position=210; Antisense; AGGAGGTCCTCCATCTTTGGACACG
>probe:Drosophila_2:1630326_at:230:89; Interrogation_Position=22; Antisense; AGTCAGCTTCTTGTGATCTTCGCTT
>probe:Drosophila_2:1630326_at:66:49; Interrogation_Position=256; Antisense; ATCCTCACATCCTCCAAGTATATTG
>probe:Drosophila_2:1630326_at:419:565; Interrogation_Position=303; Antisense; GGCAAACATACGCAGTGATCTCTCC
>probe:Drosophila_2:1630326_at:58:289; Interrogation_Position=342; Antisense; CGATACCCTTTACGTGGAAACCATG
>probe:Drosophila_2:1630326_at:166:611; Interrogation_Position=365; Antisense; TGACCATGGCGTTCTCCAAGTGTGA
>probe:Drosophila_2:1630326_at:453:329; Interrogation_Position=48; Antisense; GCTGGCCCTAAATACTCGTCTAGTA
>probe:Drosophila_2:1630326_at:160:639; Interrogation_Position=494; Antisense; TCGTCCTTGGGTGCACCTACATGGA
>probe:Drosophila_2:1630326_at:718:89; Interrogation_Position=518; Antisense; AGTACTTCAAGAACTGCCCCGATCA
>probe:Drosophila_2:1630326_at:390:531; Interrogation_Position=545; Antisense; GGTGGACTCCAAATGCCCAGTGTAC
>probe:Drosophila_2:1630326_at:554:579; Interrogation_Position=572; Antisense; TGGCCAAGGCCTACGTAACGCAGTG
>probe:Drosophila_2:1630326_at:178:145; Interrogation_Position=61; Antisense; ACTCGTCTAGTATTTGGCCAAGCCA
>probe:Drosophila_2:1630326_at:392:579; Interrogation_Position=76; Antisense; GGCCAAGCCACGATTGATTGCCAAA

Paste this into a BLAST search page for me
GCAGTGCGCCCAACGGATTTTAGGAAGGAGGTCCTCCATCTTTGGACACGAGTCAGCTTCTTGTGATCTTCGCTTATCCTCACATCCTCCAAGTATATTGGGCAAACATACGCAGTGATCTCTCCCGATACCCTTTACGTGGAAACCATGTGACCATGGCGTTCTCCAAGTGTGAGCTGGCCCTAAATACTCGTCTAGTATCGTCCTTGGGTGCACCTACATGGAAGTACTTCAAGAACTGCCCCGATCAGGTGGACTCCAAATGCCCAGTGTACTGGCCAAGGCCTACGTAACGCAGTGACTCGTCTAGTATTTGGCCAAGCCAGGCCAAGCCACGATTGATTGCCAAA

Full Affymetrix probeset data:

Annotations for 1630326_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720