FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630327_at:

>probe:Drosophila_2:1630327_at:340:627; Interrogation_Position=118; Antisense; TGCCTTTTGAGAACCCAGCACGAAA
>probe:Drosophila_2:1630327_at:290:679; Interrogation_Position=147; Antisense; TAGGCTGAAGACTGCGAGTGATCAA
>probe:Drosophila_2:1630327_at:305:653; Interrogation_Position=168; Antisense; TCAAGAGCTTGAGGACCTGCCGACT
>probe:Drosophila_2:1630327_at:584:303; Interrogation_Position=187; Antisense; CCGACTCTTTCCGAGCTATTTGAGA
>probe:Drosophila_2:1630327_at:8:617; Interrogation_Position=212; Antisense; TGCAACAGTTGAAGACGGCTGCCAC
>probe:Drosophila_2:1630327_at:81:637; Interrogation_Position=240; Antisense; TCGTCTGCTGATGCGGGAGTACCAA
>probe:Drosophila_2:1630327_at:452:363; Interrogation_Position=265; Antisense; GAATTGCTTGCCTACATGATGGACA
>probe:Drosophila_2:1630327_at:43:235; Interrogation_Position=28; Antisense; AATGCCGATCCGGTCATACGGCAAT
>probe:Drosophila_2:1630327_at:283:397; Interrogation_Position=304; Antisense; GACAGTCAGGAGTACTTCAAGGCCA
>probe:Drosophila_2:1630327_at:682:489; Interrogation_Position=315; Antisense; GTACTTCAAGGCCAAGTCTGCGCTT
>probe:Drosophila_2:1630327_at:180:579; Interrogation_Position=345; Antisense; GGCCATCCACAATCTACGGGTTTGT
>probe:Drosophila_2:1630327_at:641:691; Interrogation_Position=365; Antisense; TTTGTGCACCCACCAAACCAATGGA
>probe:Drosophila_2:1630327_at:403:141; Interrogation_Position=45; Antisense; ACGGCAATTTATTCTGCGCACTGCA
>probe:Drosophila_2:1630327_at:685:355; Interrogation_Position=62; Antisense; GCACTGCAGTCCTCAATTATCTTGG

Paste this into a BLAST search page for me
TGCCTTTTGAGAACCCAGCACGAAATAGGCTGAAGACTGCGAGTGATCAATCAAGAGCTTGAGGACCTGCCGACTCCGACTCTTTCCGAGCTATTTGAGATGCAACAGTTGAAGACGGCTGCCACTCGTCTGCTGATGCGGGAGTACCAAGAATTGCTTGCCTACATGATGGACAAATGCCGATCCGGTCATACGGCAATGACAGTCAGGAGTACTTCAAGGCCAGTACTTCAAGGCCAAGTCTGCGCTTGGCCATCCACAATCTACGGGTTTGTTTTGTGCACCCACCAAACCAATGGAACGGCAATTTATTCTGCGCACTGCAGCACTGCAGTCCTCAATTATCTTGG

Full Affymetrix probeset data:

Annotations for 1630327_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720