FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630332_at:

>probe:Drosophila_2:1630332_at:394:551; Interrogation_Position=243; Antisense; GGAGAAGTCCAGTCTGCTACGAGAT
>probe:Drosophila_2:1630332_at:248:115; Interrogation_Position=340; Antisense; AGCATGTCTGACAACGGACCCGAGT
>probe:Drosophila_2:1630332_at:592:93; Interrogation_Position=362; Antisense; AGTTCGCCCAGGTCTTCGTAATCGT
>probe:Drosophila_2:1630332_at:302:25; Interrogation_Position=391; Antisense; ATAGGTGCAGCCGTAGTCACACTCA
>probe:Drosophila_2:1630332_at:724:573; Interrogation_Position=430; Antisense; GGCGGCAATATCTCATTCTTCCAAT
>probe:Drosophila_2:1630332_at:539:289; Interrogation_Position=485; Antisense; CGGTGGCCATTTCCCTAATTGTGTG
>probe:Drosophila_2:1630332_at:705:1; Interrogation_Position=502; Antisense; ATTGTGTGCCGGGTAATCCTGCTTG
>probe:Drosophila_2:1630332_at:68:619; Interrogation_Position=542; Antisense; TGCTCTTCTTTCTGCGTTTTGTGAC
>probe:Drosophila_2:1630332_at:661:341; Interrogation_Position=598; Antisense; GCTTCCTTTGTTTTCCTGGGTCAGA
>probe:Drosophila_2:1630332_at:259:713; Interrogation_Position=673; Antisense; TTCTTCATCATCTCGTGGTTGGTTC
>probe:Drosophila_2:1630332_at:692:537; Interrogation_Position=693; Antisense; GGTTCTTTCCCACAATTAGTCCAAT
>probe:Drosophila_2:1630332_at:12:15; Interrogation_Position=707; Antisense; ATTAGTCCAATCTATGACGCCTCGT
>probe:Drosophila_2:1630332_at:447:609; Interrogation_Position=721; Antisense; TGACGCCTCGTTTAGTGATTAGTTC
>probe:Drosophila_2:1630332_at:564:509; Interrogation_Position=758; Antisense; GTGCACGTTCCATAGCGTAACCAAA

Paste this into a BLAST search page for me
GGAGAAGTCCAGTCTGCTACGAGATAGCATGTCTGACAACGGACCCGAGTAGTTCGCCCAGGTCTTCGTAATCGTATAGGTGCAGCCGTAGTCACACTCAGGCGGCAATATCTCATTCTTCCAATCGGTGGCCATTTCCCTAATTGTGTGATTGTGTGCCGGGTAATCCTGCTTGTGCTCTTCTTTCTGCGTTTTGTGACGCTTCCTTTGTTTTCCTGGGTCAGATTCTTCATCATCTCGTGGTTGGTTCGGTTCTTTCCCACAATTAGTCCAATATTAGTCCAATCTATGACGCCTCGTTGACGCCTCGTTTAGTGATTAGTTCGTGCACGTTCCATAGCGTAACCAAA

Full Affymetrix probeset data:

Annotations for 1630332_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720