FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630333_at:

>probe:Drosophila_2:1630333_at:7:555; Interrogation_Position=2867; Antisense; GGAGCCTTACTCATTAACTCATCGA
>probe:Drosophila_2:1630333_at:583:43; Interrogation_Position=2887; Antisense; ATCGAAATGCTCTTAACTTGGCTAA
>probe:Drosophila_2:1630333_at:58:151; Interrogation_Position=2902; Antisense; ACTTGGCTAAAGATTCTCGCAGGTT
>probe:Drosophila_2:1630333_at:453:487; Interrogation_Position=2942; Antisense; GTAGCCATTGCTCAAAACCATTCAT
>probe:Drosophila_2:1630333_at:33:145; Interrogation_Position=3109; Antisense; ACTCTTTCTAAGGTAACTTGGTATG
>probe:Drosophila_2:1630333_at:623:519; Interrogation_Position=3147; Antisense; GTGGAATTCCAAGCATTCTTCAAAT
>probe:Drosophila_2:1630333_at:682:189; Interrogation_Position=3201; Antisense; AACATACGCCCCAGAAATGGCCACT
>probe:Drosophila_2:1630333_at:85:69; Interrogation_Position=3217; Antisense; ATGGCCACTCATTGTTTTATTGTTC
>probe:Drosophila_2:1630333_at:226:85; Interrogation_Position=3257; Antisense; AGTGACATTCTGCAGTTTCCATTCT
>probe:Drosophila_2:1630333_at:511:479; Interrogation_Position=3271; Antisense; GTTTCCATTCTTGCTCAAATGCTAT
>probe:Drosophila_2:1630333_at:432:143; Interrogation_Position=3303; Antisense; ACTGTGTGATTTTCATCTCATTTCA
>probe:Drosophila_2:1630333_at:596:13; Interrogation_Position=3361; Antisense; ATTAGGGAGCCAGTGCAATAGTGCA
>probe:Drosophila_2:1630333_at:695:509; Interrogation_Position=3381; Antisense; GTGCATGCAAACAATGCCGGCCAAT
>probe:Drosophila_2:1630333_at:320:317; Interrogation_Position=3396; Antisense; GCCGGCCAATGTGTTTAATCGATGT

Paste this into a BLAST search page for me
GGAGCCTTACTCATTAACTCATCGAATCGAAATGCTCTTAACTTGGCTAAACTTGGCTAAAGATTCTCGCAGGTTGTAGCCATTGCTCAAAACCATTCATACTCTTTCTAAGGTAACTTGGTATGGTGGAATTCCAAGCATTCTTCAAATAACATACGCCCCAGAAATGGCCACTATGGCCACTCATTGTTTTATTGTTCAGTGACATTCTGCAGTTTCCATTCTGTTTCCATTCTTGCTCAAATGCTATACTGTGTGATTTTCATCTCATTTCAATTAGGGAGCCAGTGCAATAGTGCAGTGCATGCAAACAATGCCGGCCAATGCCGGCCAATGTGTTTAATCGATGT

Full Affymetrix probeset data:

Annotations for 1630333_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720