FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630334_at:

>probe:Drosophila_2:1630334_at:502:439; Interrogation_Position=1059; Antisense; GATGGTAGCCAACATCTTCACGGGC
>probe:Drosophila_2:1630334_at:24:191; Interrogation_Position=1111; Antisense; AACATCTTTGATGCCGTGCACACTC
>probe:Drosophila_2:1630334_at:42:511; Interrogation_Position=1126; Antisense; GTGCACACTCAGCTGGATCCGAATA
>probe:Drosophila_2:1630334_at:404:29; Interrogation_Position=1203; Antisense; ATACTTGGTGGATCGCTATGGGCGC
>probe:Drosophila_2:1630334_at:9:99; Interrogation_Position=1229; Antisense; AGATCCTGCTGATAGTGTCCTGTGC
>probe:Drosophila_2:1630334_at:364:347; Interrogation_Position=1252; Antisense; GCAGGCAGTGGCATCGGAACTTCCG
>probe:Drosophila_2:1630334_at:249:561; Interrogation_Position=1267; Antisense; GGAACTTCCGCCTTTGGACTGTACG
>probe:Drosophila_2:1630334_at:305:407; Interrogation_Position=1283; Antisense; GACTGTACGCCTTCTATGCGGAGGA
>probe:Drosophila_2:1630334_at:34:713; Interrogation_Position=1363; Antisense; TTCATCATCTTCATTGCCAACGTGG
>probe:Drosophila_2:1630334_at:191:195; Interrogation_Position=1381; Antisense; AACGTGGGCGTTATCTCGGTGACGA
>probe:Drosophila_2:1630334_at:54:335; Interrogation_Position=1497; Antisense; GCTGAAGACTTTTCCACTGATGATG
>probe:Drosophila_2:1630334_at:377:143; Interrogation_Position=1512; Antisense; ACTGATGATGTTTCACCTGGGTCTG
>probe:Drosophila_2:1630334_at:371:495; Interrogation_Position=1564; Antisense; GTCAGCGTCATTTGTCTGTTCTATG
>probe:Drosophila_2:1630334_at:713:251; Interrogation_Position=1611; Antisense; CAAGGGTCGCTCCATGTATGACTAA

Paste this into a BLAST search page for me
GATGGTAGCCAACATCTTCACGGGCAACATCTTTGATGCCGTGCACACTCGTGCACACTCAGCTGGATCCGAATAATACTTGGTGGATCGCTATGGGCGCAGATCCTGCTGATAGTGTCCTGTGCGCAGGCAGTGGCATCGGAACTTCCGGGAACTTCCGCCTTTGGACTGTACGGACTGTACGCCTTCTATGCGGAGGATTCATCATCTTCATTGCCAACGTGGAACGTGGGCGTTATCTCGGTGACGAGCTGAAGACTTTTCCACTGATGATGACTGATGATGTTTCACCTGGGTCTGGTCAGCGTCATTTGTCTGTTCTATGCAAGGGTCGCTCCATGTATGACTAA

Full Affymetrix probeset data:

Annotations for 1630334_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720