FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630337_at:

>probe:Drosophila_2:1630337_at:8:343; Interrogation_Position=113; Antisense; GCTTTATGCCCTTCGAATCGGATTT
>probe:Drosophila_2:1630337_at:375:143; Interrogation_Position=138; Antisense; ACTACTGCCATTGAATATCCTGCGC
>probe:Drosophila_2:1630337_at:586:453; Interrogation_Position=182; Antisense; GATCATCGCGTTACATTGGTCAGAG
>probe:Drosophila_2:1630337_at:129:415; Interrogation_Position=257; Antisense; GAGCCAATCCTTTGAGGGAGGCCAA
>probe:Drosophila_2:1630337_at:267:69; Interrogation_Position=275; Antisense; AGGCCAAAGGTGTTCAGCTCTATAA
>probe:Drosophila_2:1630337_at:91:655; Interrogation_Position=32; Antisense; TAATTCTGAGCCTTTTTGGCCTGGT
>probe:Drosophila_2:1630337_at:298:371; Interrogation_Position=354; Antisense; GAAGGGAACTGCACCGGCCAATTAT
>probe:Drosophila_2:1630337_at:344:457; Interrogation_Position=401; Antisense; GATACCAGAGCTACGATTCACCATG
>probe:Drosophila_2:1630337_at:210:11; Interrogation_Position=416; Antisense; ATTCACCATGGATGCCCTCGAAATG
>probe:Drosophila_2:1630337_at:554:227; Interrogation_Position=437; Antisense; AATGGAGACCGACCAGCGAATTTCT
>probe:Drosophila_2:1630337_at:660:243; Interrogation_Position=454; Antisense; GAATTTCTGGGTGTGACCTCCTCAT
>probe:Drosophila_2:1630337_at:193:575; Interrogation_Position=554; Antisense; GGCGGCAGGATATATGGCCCCACAA
>probe:Drosophila_2:1630337_at:578:101; Interrogation_Position=59; Antisense; AGAGTTATGGCCATCAGCCGGTACT
>probe:Drosophila_2:1630337_at:467:647; Interrogation_Position=92; Antisense; TCATCAAAGTGCGAGCCAGCGGCTT

Paste this into a BLAST search page for me
GCTTTATGCCCTTCGAATCGGATTTACTACTGCCATTGAATATCCTGCGCGATCATCGCGTTACATTGGTCAGAGGAGCCAATCCTTTGAGGGAGGCCAAAGGCCAAAGGTGTTCAGCTCTATAATAATTCTGAGCCTTTTTGGCCTGGTGAAGGGAACTGCACCGGCCAATTATGATACCAGAGCTACGATTCACCATGATTCACCATGGATGCCCTCGAAATGAATGGAGACCGACCAGCGAATTTCTGAATTTCTGGGTGTGACCTCCTCATGGCGGCAGGATATATGGCCCCACAAAGAGTTATGGCCATCAGCCGGTACTTCATCAAAGTGCGAGCCAGCGGCTT

Full Affymetrix probeset data:

Annotations for 1630337_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720