FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630340_at:

>probe:Drosophila_2:1630340_at:655:221; Interrogation_Position=1260; Antisense; AAGGGCCAAGTGTTCGTGCGCAAGT
>probe:Drosophila_2:1630340_at:477:347; Interrogation_Position=1291; Antisense; GCATCGGCTCGTGGGACATGTCCAA
>probe:Drosophila_2:1630340_at:262:269; Interrogation_Position=1307; Antisense; CATGTCCAAGGAGAGGCCGCCGAAT
>probe:Drosophila_2:1630340_at:11:319; Interrogation_Position=1325; Antisense; GCCGAATGGTTTTGCGTCGATGCAT
>probe:Drosophila_2:1630340_at:719:251; Interrogation_Position=1365; Antisense; CAAATGGATACGTTCTTCGGTCCCG
>probe:Drosophila_2:1630340_at:651:33; Interrogation_Position=1398; Antisense; ATCAAAGGCGGTACGGATCTCTCCA
>probe:Drosophila_2:1630340_at:326:453; Interrogation_Position=1413; Antisense; GATCTCTCCATCATTGGTACCTCAG
>probe:Drosophila_2:1630340_at:132:147; Interrogation_Position=1480; Antisense; ACTACTGGCCCTCTGGAAGTTCCAA
>probe:Drosophila_2:1630340_at:498:711; Interrogation_Position=1536; Antisense; TTCAGCCACTACAGCAACAACTTTG
>probe:Drosophila_2:1630340_at:574:159; Interrogation_Position=1552; Antisense; ACAACTTTGTCAAGGGTGCCACTCT
>probe:Drosophila_2:1630340_at:93:627; Interrogation_Position=1579; Antisense; TGCCGCCCTAGAATAGCTATCCGAA
>probe:Drosophila_2:1630340_at:412:451; Interrogation_Position=1596; Antisense; TATCCGAAACTAACCCAGGTCGTGG
>probe:Drosophila_2:1630340_at:357:111; Interrogation_Position=1687; Antisense; AGCAATTTCTTCTTCATCGTGGATT
>probe:Drosophila_2:1630340_at:311:41; Interrogation_Position=1702; Antisense; ATCGTGGATTGACGGCCATTGGCAT

Paste this into a BLAST search page for me
AAGGGCCAAGTGTTCGTGCGCAAGTGCATCGGCTCGTGGGACATGTCCAACATGTCCAAGGAGAGGCCGCCGAATGCCGAATGGTTTTGCGTCGATGCATCAAATGGATACGTTCTTCGGTCCCGATCAAAGGCGGTACGGATCTCTCCAGATCTCTCCATCATTGGTACCTCAGACTACTGGCCCTCTGGAAGTTCCAATTCAGCCACTACAGCAACAACTTTGACAACTTTGTCAAGGGTGCCACTCTTGCCGCCCTAGAATAGCTATCCGAATATCCGAAACTAACCCAGGTCGTGGAGCAATTTCTTCTTCATCGTGGATTATCGTGGATTGACGGCCATTGGCAT

Full Affymetrix probeset data:

Annotations for 1630340_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720