Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630341_at:

>probe:Drosophila_2:1630341_at:62:247; Interrogation_Position=2670; Antisense; AATTGAAATCGCATCCTGCAACCGA
>probe:Drosophila_2:1630341_at:641:47; Interrogation_Position=2682; Antisense; ATCCTGCAACCGATACGGATGGAGA
>probe:Drosophila_2:1630341_at:254:139; Interrogation_Position=2708; Antisense; ACGATATAGCATTTATCTGCCCGAG
>probe:Drosophila_2:1630341_at:608:37; Interrogation_Position=2722; Antisense; ATCTGCCCGAGAACCACATTTTTAT
>probe:Drosophila_2:1630341_at:467:429; Interrogation_Position=2771; Antisense; GAGTATTTCAGCATTTTGCTCTCTG
>probe:Drosophila_2:1630341_at:637:619; Interrogation_Position=2787; Antisense; TGCTCTCTGTCTCTTGTCAATATTG
>probe:Drosophila_2:1630341_at:111:495; Interrogation_Position=2802; Antisense; GTCAATATTGATTTGTGTGCGTGTG
>probe:Drosophila_2:1630341_at:235:203; Interrogation_Position=2842; Antisense; AACCAGCCCATAAAACATTGTTCGA
>probe:Drosophila_2:1630341_at:157:671; Interrogation_Position=3021; Antisense; TAGCGTTAGGCGGAAGAGCATATAC
>probe:Drosophila_2:1630341_at:485:213; Interrogation_Position=3034; Antisense; AAGAGCATATACAATTTCGACATAA
>probe:Drosophila_2:1630341_at:431:517; Interrogation_Position=3090; Antisense; GTGTGAAAAGTTTGTACGCTCCAGA
>probe:Drosophila_2:1630341_at:112:489; Interrogation_Position=3103; Antisense; GTACGCTCCAGACATACACATATGC
>probe:Drosophila_2:1630341_at:378:685; Interrogation_Position=3131; Antisense; TATCTAAACACATTCCCGATTTCGA
>probe:Drosophila_2:1630341_at:589:675; Interrogation_Position=3173; Antisense; TAGCTTACATTCTTTGTTCTGTTTT

Paste this into a BLAST search page for me
AATTGAAATCGCATCCTGCAACCGAATCCTGCAACCGATACGGATGGAGAACGATATAGCATTTATCTGCCCGAGATCTGCCCGAGAACCACATTTTTATGAGTATTTCAGCATTTTGCTCTCTGTGCTCTCTGTCTCTTGTCAATATTGGTCAATATTGATTTGTGTGCGTGTGAACCAGCCCATAAAACATTGTTCGATAGCGTTAGGCGGAAGAGCATATACAAGAGCATATACAATTTCGACATAAGTGTGAAAAGTTTGTACGCTCCAGAGTACGCTCCAGACATACACATATGCTATCTAAACACATTCCCGATTTCGATAGCTTACATTCTTTGTTCTGTTTT

Full Affymetrix probeset data:

Annotations for 1630341_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime