FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630343_at:

>probe:Drosophila_2:1630343_at:699:595; Interrogation_Position=2163; Antisense; TGTGAAAACGGCTTGGCTATCTCCC
>probe:Drosophila_2:1630343_at:213:701; Interrogation_Position=2229; Antisense; TTTTTTGGCCGACGTCACAAGATAA
>probe:Drosophila_2:1630343_at:382:325; Interrogation_Position=2255; Antisense; GCGAACTGATATGCAGTCTGCACTC
>probe:Drosophila_2:1630343_at:98:499; Interrogation_Position=2270; Antisense; GTCTGCACTCCATACTAAACGTTAG
>probe:Drosophila_2:1630343_at:465:113; Interrogation_Position=2323; Antisense; AGCAGTGGAGCCAGTACTTTATATT
>probe:Drosophila_2:1630343_at:59:17; Interrogation_Position=2345; Antisense; ATTTAATTTCCACTCGAACTGAACG
>probe:Drosophila_2:1630343_at:469:709; Interrogation_Position=2394; Antisense; TTAACTACTCACTAACCCACTAAGT
>probe:Drosophila_2:1630343_at:523:473; Interrogation_Position=2417; Antisense; GTTACCTTGCGAACTCATAGTGCTT
>probe:Drosophila_2:1630343_at:125:25; Interrogation_Position=2433; Antisense; ATAGTGCTTGAAATCCCTTTCTCAT
>probe:Drosophila_2:1630343_at:540:235; Interrogation_Position=2444; Antisense; AATCCCTTTCTCATTTCCCTATGTT
>probe:Drosophila_2:1630343_at:493:349; Interrogation_Position=2559; Antisense; GCAGGTGAAGCCGTTTGACCACAAG
>probe:Drosophila_2:1630343_at:532:413; Interrogation_Position=2575; Antisense; GACCACAAGTATCCTACGTTTTAAG
>probe:Drosophila_2:1630343_at:352:613; Interrogation_Position=2637; Antisense; TGCAAAGCACACTCCCTATTAATTT
>probe:Drosophila_2:1630343_at:289:13; Interrogation_Position=2654; Antisense; ATTAATTTCGCTTTTCGCAGCTGTC

Paste this into a BLAST search page for me
TGTGAAAACGGCTTGGCTATCTCCCTTTTTTGGCCGACGTCACAAGATAAGCGAACTGATATGCAGTCTGCACTCGTCTGCACTCCATACTAAACGTTAGAGCAGTGGAGCCAGTACTTTATATTATTTAATTTCCACTCGAACTGAACGTTAACTACTCACTAACCCACTAAGTGTTACCTTGCGAACTCATAGTGCTTATAGTGCTTGAAATCCCTTTCTCATAATCCCTTTCTCATTTCCCTATGTTGCAGGTGAAGCCGTTTGACCACAAGGACCACAAGTATCCTACGTTTTAAGTGCAAAGCACACTCCCTATTAATTTATTAATTTCGCTTTTCGCAGCTGTC

Full Affymetrix probeset data:

Annotations for 1630343_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720