FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630344_at:

>probe:Drosophila_2:1630344_at:267:589; Interrogation_Position=1021; Antisense; TGGATGGATGCTACCACTCTGCTAA
>probe:Drosophila_2:1630344_at:629:659; Interrogation_Position=1043; Antisense; TAACTGGCAGCTGGGATCACACACT
>probe:Drosophila_2:1630344_at:31:505; Interrogation_Position=1122; Antisense; GTCCATATTCGATGCGAGCTACTCA
>probe:Drosophila_2:1630344_at:604:603; Interrogation_Position=1160; Antisense; TGATACTGACTGCTTCGGCGGACAA
>probe:Drosophila_2:1630344_at:107:239; Interrogation_Position=1186; Antisense; AATCTGCGGCTCTATGATCCTAGGA
>probe:Drosophila_2:1630344_at:73:675; Interrogation_Position=1236; Antisense; TACCTATCTGGGACACAATGCCTGG
>probe:Drosophila_2:1630344_at:706:233; Interrogation_Position=1252; Antisense; AATGCCTGGGTGCAGACCGTCATGT
>probe:Drosophila_2:1630344_at:79:547; Interrogation_Position=1287; Antisense; GGAGGAGTTCCTATTTGTCTCCGGC
>probe:Drosophila_2:1630344_at:214:631; Interrogation_Position=1306; Antisense; TCCGGCGCTTATGACAACCAGAACA
>probe:Drosophila_2:1630344_at:267:601; Interrogation_Position=1364; Antisense; TGTACGATCTTCTGGGTCACGGTGA
>probe:Drosophila_2:1630344_at:530:169; Interrogation_Position=1389; Antisense; AAAGGTCCTGGACATCGACTGGTCC
>probe:Drosophila_2:1630344_at:391:407; Interrogation_Position=1405; Antisense; GACTGGTCCAATCCCAAGTACATTG
>probe:Drosophila_2:1630344_at:386:187; Interrogation_Position=1447; Antisense; AACACGGTGCGCGTATTCAAATCTC
>probe:Drosophila_2:1630344_at:161:43; Interrogation_Position=995; Antisense; ATCGTGAGAGCGTATCAGCCGTGCA

Paste this into a BLAST search page for me
TGGATGGATGCTACCACTCTGCTAATAACTGGCAGCTGGGATCACACACTGTCCATATTCGATGCGAGCTACTCATGATACTGACTGCTTCGGCGGACAAAATCTGCGGCTCTATGATCCTAGGATACCTATCTGGGACACAATGCCTGGAATGCCTGGGTGCAGACCGTCATGTGGAGGAGTTCCTATTTGTCTCCGGCTCCGGCGCTTATGACAACCAGAACATGTACGATCTTCTGGGTCACGGTGAAAAGGTCCTGGACATCGACTGGTCCGACTGGTCCAATCCCAAGTACATTGAACACGGTGCGCGTATTCAAATCTCATCGTGAGAGCGTATCAGCCGTGCA

Full Affymetrix probeset data:

Annotations for 1630344_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720