FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630345_at:

>probe:Drosophila_2:1630345_at:347:23; Interrogation_Position=1048; Antisense; ATATCACCGCATTCTCCGGGCAGAT
>probe:Drosophila_2:1630345_at:526:127; Interrogation_Position=1105; Antisense; ACCACGGAGTACTATGCGCAAAGAC
>probe:Drosophila_2:1630345_at:61:325; Interrogation_Position=1135; Antisense; GCGAATAGAACCAGCATGAGCCCCA
>probe:Drosophila_2:1630345_at:263:73; Interrogation_Position=1159; Antisense; AGTCCAAGTCAAAACCAGGGCTCTC
>probe:Drosophila_2:1630345_at:184:83; Interrogation_Position=1175; Antisense; AGGGCTCTCGATGGTACCGCCAGCA
>probe:Drosophila_2:1630345_at:513:301; Interrogation_Position=1211; Antisense; CCCGGTTGAGTGTGGGTCACCAGCA
>probe:Drosophila_2:1630345_at:26:437; Interrogation_Position=1283; Antisense; GAGGACGAACCCTGGTGCACATTGT
>probe:Drosophila_2:1630345_at:48:511; Interrogation_Position=1297; Antisense; GTGCACATTGTATCCGACCAGAGTA
>probe:Drosophila_2:1630345_at:652:95; Interrogation_Position=1316; Antisense; AGAGTAAGACCATGACGCCACCAAC
>probe:Drosophila_2:1630345_at:408:523; Interrogation_Position=1349; Antisense; GGGCGCCAACAAGAATCCAGCTGTA
>probe:Drosophila_2:1630345_at:291:153; Interrogation_Position=1398; Antisense; ACAGGCAACGACCTACTTTGGCGGC
>probe:Drosophila_2:1630345_at:282:145; Interrogation_Position=1424; Antisense; ACTACAATGCACCTGTTAAGCCCGG
>probe:Drosophila_2:1630345_at:306:411; Interrogation_Position=1598; Antisense; GACGCAACCGTTCGCCGATCAAAAT
>probe:Drosophila_2:1630345_at:326:315; Interrogation_Position=1611; Antisense; GCCGATCAAAATGCCCTGGCGGTAG

Paste this into a BLAST search page for me
ATATCACCGCATTCTCCGGGCAGATACCACGGAGTACTATGCGCAAAGACGCGAATAGAACCAGCATGAGCCCCAAGTCCAAGTCAAAACCAGGGCTCTCAGGGCTCTCGATGGTACCGCCAGCACCCGGTTGAGTGTGGGTCACCAGCAGAGGACGAACCCTGGTGCACATTGTGTGCACATTGTATCCGACCAGAGTAAGAGTAAGACCATGACGCCACCAACGGGCGCCAACAAGAATCCAGCTGTAACAGGCAACGACCTACTTTGGCGGCACTACAATGCACCTGTTAAGCCCGGGACGCAACCGTTCGCCGATCAAAATGCCGATCAAAATGCCCTGGCGGTAG

Full Affymetrix probeset data:

Annotations for 1630345_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720