FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630346_at:

>probe:Drosophila_2:1630346_at:127:453; Interrogation_Position=1087; Antisense; GATCTTGCCAATACAGGGGACTTCA
>probe:Drosophila_2:1630346_at:587:525; Interrogation_Position=1103; Antisense; GGGACTTCATTGACACGCAGTGGAC
>probe:Drosophila_2:1630346_at:116:403; Interrogation_Position=1105; Antisense; GACTTCATTGACACGCAGTGGACAC
>probe:Drosophila_2:1630346_at:177:713; Interrogation_Position=1108; Antisense; TTCATTGACACGCAGTGGACACAGT
>probe:Drosophila_2:1630346_at:363:7; Interrogation_Position=1111; Antisense; ATTGACACGCAGTGGACACAGTGGA
>probe:Drosophila_2:1630346_at:721:611; Interrogation_Position=1113; Antisense; TGACACGCAGTGGACACAGTGGAGT
>probe:Drosophila_2:1630346_at:387:259; Interrogation_Position=1116; Antisense; CACGCAGTGGACACAGTGGAGTGCC
>probe:Drosophila_2:1630346_at:678:83; Interrogation_Position=1121; Antisense; AGTGGACACAGTGGAGTGCCACAAA
>probe:Drosophila_2:1630346_at:50:521; Interrogation_Position=1131; Antisense; GTGGAGTGCCACAAAGAGAGACAGA
>probe:Drosophila_2:1630346_at:333:433; Interrogation_Position=1134; Antisense; GAGTGCCACAAAGAGAGACAGACCG
>probe:Drosophila_2:1630346_at:51:257; Interrogation_Position=1142; Antisense; CAAAGAGAGACAGACCGCAAGGACC
>probe:Drosophila_2:1630346_at:89:425; Interrogation_Position=1148; Antisense; GAGACAGACCGCAAGGACCGCAGAA
>probe:Drosophila_2:1630346_at:531:399; Interrogation_Position=1150; Antisense; GACAGACCGCAAGGACCGCAGAATG
>probe:Drosophila_2:1630346_at:336:263; Interrogation_Position=1152; Antisense; CAGACCGCAAGGACCGCAGAATGGG

Paste this into a BLAST search page for me
GATCTTGCCAATACAGGGGACTTCAGGGACTTCATTGACACGCAGTGGACGACTTCATTGACACGCAGTGGACACTTCATTGACACGCAGTGGACACAGTATTGACACGCAGTGGACACAGTGGATGACACGCAGTGGACACAGTGGAGTCACGCAGTGGACACAGTGGAGTGCCAGTGGACACAGTGGAGTGCCACAAAGTGGAGTGCCACAAAGAGAGACAGAGAGTGCCACAAAGAGAGACAGACCGCAAAGAGAGACAGACCGCAAGGACCGAGACAGACCGCAAGGACCGCAGAAGACAGACCGCAAGGACCGCAGAATGCAGACCGCAAGGACCGCAGAATGGG

Full Affymetrix probeset data:

Annotations for 1630346_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720