Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630347_at:

>probe:Drosophila_2:1630347_at:2:171; Interrogation_Position=1254; Antisense; AAAGGAGTCAACATCAGCGCGACAA
>probe:Drosophila_2:1630347_at:491:323; Interrogation_Position=1272; Antisense; GCGACAACTGCGTGAAAGCTTTCCG
>probe:Drosophila_2:1630347_at:384:205; Interrogation_Position=1287; Antisense; AAGCTTTCCGAGAGGGCAGCATTTG
>probe:Drosophila_2:1630347_at:730:345; Interrogation_Position=1305; Antisense; GCATTTGGGTGCTCATCTGTACGGA
>probe:Drosophila_2:1630347_at:559:63; Interrogation_Position=1334; Antisense; ATGGGCCGCGGCATTGACTTCAAGG
>probe:Drosophila_2:1630347_at:56:641; Interrogation_Position=1366; Antisense; TCTGGTGATCAACTACGACTTTCCG
>probe:Drosophila_2:1630347_at:596:693; Interrogation_Position=1401; Antisense; TTTCGTACATTCATCGGATCGGCAG
>probe:Drosophila_2:1630347_at:186:527; Interrogation_Position=1447; Antisense; GGGACGCGCAATTACGTTTTTCACA
>probe:Drosophila_2:1630347_at:634:477; Interrogation_Position=1462; Antisense; GTTTTTCACACAAGAGGACACGTCC
>probe:Drosophila_2:1630347_at:298:505; Interrogation_Position=1483; Antisense; GTCCAATTTGAGAGGCATCGCGCTT
>probe:Drosophila_2:1630347_at:684:131; Interrogation_Position=1529; Antisense; ACCGTTCCGGAATATATGTTGCAAA
>probe:Drosophila_2:1630347_at:602:587; Interrogation_Position=1602; Antisense; TGGATCGCGAGGACATTTCGACCAA
>probe:Drosophila_2:1630347_at:20:577; Interrogation_Position=1646; Antisense; GGCGACGAGAAGCACAAATCCACCA
>probe:Drosophila_2:1630347_at:378:181; Interrogation_Position=1766; Antisense; AAAACAGAACTTAAGCCAGCCGGCA

Paste this into a BLAST search page for me
AAAGGAGTCAACATCAGCGCGACAAGCGACAACTGCGTGAAAGCTTTCCGAAGCTTTCCGAGAGGGCAGCATTTGGCATTTGGGTGCTCATCTGTACGGAATGGGCCGCGGCATTGACTTCAAGGTCTGGTGATCAACTACGACTTTCCGTTTCGTACATTCATCGGATCGGCAGGGGACGCGCAATTACGTTTTTCACAGTTTTTCACACAAGAGGACACGTCCGTCCAATTTGAGAGGCATCGCGCTTACCGTTCCGGAATATATGTTGCAAATGGATCGCGAGGACATTTCGACCAAGGCGACGAGAAGCACAAATCCACCAAAAACAGAACTTAAGCCAGCCGGCA

Full Affymetrix probeset data:

Annotations for 1630347_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime