FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630351_at:

>probe:Drosophila_2:1630351_at:56:167; Interrogation_Position=117; Antisense; AAATGTTTGGCGATCCGGATTTGGA
>probe:Drosophila_2:1630351_at:383:489; Interrogation_Position=157; Antisense; GTACGTCGGAAACATGCAGCGCTAC
>probe:Drosophila_2:1630351_at:555:123; Interrogation_Position=174; Antisense; AGCGCTACCGCGAGAACATCATAAT
>probe:Drosophila_2:1630351_at:518:461; Interrogation_Position=273; Antisense; GATTCAAATGCACCATGGCCTGTGT
>probe:Drosophila_2:1630351_at:200:347; Interrogation_Position=317; Antisense; GCAGCTTTGGGTTTGTTTAGCGCCT
>probe:Drosophila_2:1630351_at:230:473; Interrogation_Position=344; Antisense; GTTAATCCCAACATGGCCGATCCGT
>probe:Drosophila_2:1630351_at:367:581; Interrogation_Position=357; Antisense; TGGCCGATCCGTTCGCGAATGAGAA
>probe:Drosophila_2:1630351_at:484:435; Interrogation_Position=398; Antisense; GAGGTTTTCCGCGAAATGCGCTCCA
>probe:Drosophila_2:1630351_at:512:209; Interrogation_Position=440; Antisense; AAGAATTTCGCGCTCATCGGCTGTG
>probe:Drosophila_2:1630351_at:463:431; Interrogation_Position=479; Antisense; GAGTGCACCATCGAGAGCCATCGGG
>probe:Drosophila_2:1630351_at:87:111; Interrogation_Position=519; Antisense; AGAATGGCACCTACGCTGGAGGCAT
>probe:Drosophila_2:1630351_at:289:133; Interrogation_Position=531; Antisense; ACGCTGGAGGCATCACTGGAGGACT
>probe:Drosophila_2:1630351_at:684:141; Interrogation_Position=620; Antisense; ACGGCCATCGACTACTACATGTATT
>probe:Drosophila_2:1630351_at:663:365; Interrogation_Position=95; Antisense; GAATCGTCGGTGACGGCGCCCAAAA

Paste this into a BLAST search page for me
AAATGTTTGGCGATCCGGATTTGGAGTACGTCGGAAACATGCAGCGCTACAGCGCTACCGCGAGAACATCATAATGATTCAAATGCACCATGGCCTGTGTGCAGCTTTGGGTTTGTTTAGCGCCTGTTAATCCCAACATGGCCGATCCGTTGGCCGATCCGTTCGCGAATGAGAAGAGGTTTTCCGCGAAATGCGCTCCAAAGAATTTCGCGCTCATCGGCTGTGGAGTGCACCATCGAGAGCCATCGGGAGAATGGCACCTACGCTGGAGGCATACGCTGGAGGCATCACTGGAGGACTACGGCCATCGACTACTACATGTATTGAATCGTCGGTGACGGCGCCCAAAA

Full Affymetrix probeset data:

Annotations for 1630351_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720