FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630352_at:

>probe:Drosophila_2:1630352_at:721:441; Interrogation_Position=106; Antisense; GATGTGATCAGCGATCGTCGTTTCC
>probe:Drosophila_2:1630352_at:415:501; Interrogation_Position=122; Antisense; GTCGTTTCCGTTGGGAATTCTCGCA
>probe:Drosophila_2:1630352_at:283:527; Interrogation_Position=134; Antisense; GGGAATTCTCGCAGGACTCGGATGA
>probe:Drosophila_2:1630352_at:515:405; Interrogation_Position=148; Antisense; GACTCGGATGAGTCTGCCAACGACT
>probe:Drosophila_2:1630352_at:133:323; Interrogation_Position=15; Antisense; GCAGTCTAACAAGGTTTTCTTCGTG
>probe:Drosophila_2:1630352_at:255:569; Interrogation_Position=220; Antisense; GGCAGTGCATCCGAAGAAATTTTGA
>probe:Drosophila_2:1630352_at:227:453; Interrogation_Position=243; Antisense; GATCATCGAGTATCCTGAAGGCTAC
>probe:Drosophila_2:1630352_at:535:613; Interrogation_Position=258; Antisense; TGAAGGCTACGAAAGCGGCTCCAAT
>probe:Drosophila_2:1630352_at:94:337; Interrogation_Position=275; Antisense; GCTCCAATGAAAGCGCCTCCGATGA
>probe:Drosophila_2:1630352_at:508:305; Interrogation_Position=290; Antisense; CCTCCGATGAAAGCGTCTCCGATGA
>probe:Drosophila_2:1630352_at:264:445; Interrogation_Position=310; Antisense; GATGAAAGCGCCTCCAATGAATCTT
>probe:Drosophila_2:1630352_at:36:647; Interrogation_Position=32; Antisense; TCTTCGTGTTCTTTGGTATCATCGC
>probe:Drosophila_2:1630352_at:291:483; Interrogation_Position=47; Antisense; GTATCATCGCCATGGTGATCGCCGC
>probe:Drosophila_2:1630352_at:678:497; Interrogation_Position=74; Antisense; GTCTCTCCTCGGATGTTGTGGACAA

Paste this into a BLAST search page for me
GATGTGATCAGCGATCGTCGTTTCCGTCGTTTCCGTTGGGAATTCTCGCAGGGAATTCTCGCAGGACTCGGATGAGACTCGGATGAGTCTGCCAACGACTGCAGTCTAACAAGGTTTTCTTCGTGGGCAGTGCATCCGAAGAAATTTTGAGATCATCGAGTATCCTGAAGGCTACTGAAGGCTACGAAAGCGGCTCCAATGCTCCAATGAAAGCGCCTCCGATGACCTCCGATGAAAGCGTCTCCGATGAGATGAAAGCGCCTCCAATGAATCTTTCTTCGTGTTCTTTGGTATCATCGCGTATCATCGCCATGGTGATCGCCGCGTCTCTCCTCGGATGTTGTGGACAA

Full Affymetrix probeset data:

Annotations for 1630352_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720