Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630353_at:

>probe:Drosophila_2:1630353_at:588:457; Interrogation_Position=1020; Antisense; GATATCTCATATTTCAGTTCAGCAT
>probe:Drosophila_2:1630353_at:90:93; Interrogation_Position=1035; Antisense; AGTTCAGCATCTACGTTTGACTATA
>probe:Drosophila_2:1630353_at:241:303; Interrogation_Position=536; Antisense; CCGCCTATGTAGCTGGACCAATGGG
>probe:Drosophila_2:1630353_at:321:555; Interrogation_Position=550; Antisense; GGACCAATGGGCGTTATCCACTATC
>probe:Drosophila_2:1630353_at:152:459; Interrogation_Position=580; Antisense; GATATGCAAACGCACTTGGCTCTGC
>probe:Drosophila_2:1630353_at:537:5; Interrogation_Position=646; Antisense; ATTGAATCCAACTCATGTTTCCATG
>probe:Drosophila_2:1630353_at:536:421; Interrogation_Position=697; Antisense; GAGAATGAGCACACCGATGACGACG
>probe:Drosophila_2:1630353_at:462:611; Interrogation_Position=714; Antisense; TGACGACGAGGGATACGGCTATGAA
>probe:Drosophila_2:1630353_at:543:465; Interrogation_Position=747; Antisense; GATTGTTCTCTGCTTAAACCGTTCA
>probe:Drosophila_2:1630353_at:13:475; Interrogation_Position=767; Antisense; GTTCAAATTCAGAGTCCGGCGCAGC
>probe:Drosophila_2:1630353_at:382:323; Interrogation_Position=785; Antisense; GCGCAGCTGAGGAATCTGGCGATTC
>probe:Drosophila_2:1630353_at:572:463; Interrogation_Position=805; Antisense; GATTCGCAGCGTTCGTCAAAGAGTT
>probe:Drosophila_2:1630353_at:106:679; Interrogation_Position=928; Antisense; TATACCACCGAGCAGGGTTACCTGG
>probe:Drosophila_2:1630353_at:639:1; Interrogation_Position=952; Antisense; GTTGAGGAACCCACCAGCGAACCAT

Paste this into a BLAST search page for me
GATATCTCATATTTCAGTTCAGCATAGTTCAGCATCTACGTTTGACTATACCGCCTATGTAGCTGGACCAATGGGGGACCAATGGGCGTTATCCACTATCGATATGCAAACGCACTTGGCTCTGCATTGAATCCAACTCATGTTTCCATGGAGAATGAGCACACCGATGACGACGTGACGACGAGGGATACGGCTATGAAGATTGTTCTCTGCTTAAACCGTTCAGTTCAAATTCAGAGTCCGGCGCAGCGCGCAGCTGAGGAATCTGGCGATTCGATTCGCAGCGTTCGTCAAAGAGTTTATACCACCGAGCAGGGTTACCTGGGTTGAGGAACCCACCAGCGAACCAT

Full Affymetrix probeset data:

Annotations for 1630353_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime