FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630354_at:

>probe:Drosophila_2:1630354_at:625:669; Interrogation_Position=209; Antisense; TACTCCTTGTGTATGCTGCTTCGAA
>probe:Drosophila_2:1630354_at:310:3; Interrogation_Position=264; Antisense; ATTGGCCGTTCAGGTGTTCATCATA
>probe:Drosophila_2:1630354_at:533:239; Interrogation_Position=309; Antisense; AATCATGGCCTGTCGCTGCAAATAT
>probe:Drosophila_2:1630354_at:467:451; Interrogation_Position=342; Antisense; GATCTTTACCAAGTGCTGCTACTGC
>probe:Drosophila_2:1630354_at:171:547; Interrogation_Position=397; Antisense; GGATGCATTTTTCTAACCTGGTTCA
>probe:Drosophila_2:1630354_at:614:41; Interrogation_Position=433; Antisense; ATCGGCACCGGCTTCATGATGGAGT
>probe:Drosophila_2:1630354_at:98:67; Interrogation_Position=451; Antisense; ATGGAGTGCATCTTTCCGAACGAGT
>probe:Drosophila_2:1630354_at:555:379; Interrogation_Position=468; Antisense; GAACGAGTATCAGAGGTCCCTTATC
>probe:Drosophila_2:1630354_at:634:275; Interrogation_Position=534; Antisense; CTTCGGCATCATAGTTTCGGCCATG
>probe:Drosophila_2:1630354_at:567:619; Interrogation_Position=557; Antisense; TGCTCTGCCTGGGAGTGCACAATAA
>probe:Drosophila_2:1630354_at:411:315; Interrogation_Position=600; Antisense; GCCATTTTTGGTTTTCACACCCATT
>probe:Drosophila_2:1630354_at:207:249; Interrogation_Position=630; Antisense; AATTGTGCACATTTTTGCCCTGACC
>probe:Drosophila_2:1630354_at:278:625; Interrogation_Position=645; Antisense; TGCCCTGACCGTTTACAGCTTTAAT
>probe:Drosophila_2:1630354_at:65:333; Interrogation_Position=723; Antisense; GCTGGTGGTTTGGTCCTACTACATA

Paste this into a BLAST search page for me
TACTCCTTGTGTATGCTGCTTCGAAATTGGCCGTTCAGGTGTTCATCATAAATCATGGCCTGTCGCTGCAAATATGATCTTTACCAAGTGCTGCTACTGCGGATGCATTTTTCTAACCTGGTTCAATCGGCACCGGCTTCATGATGGAGTATGGAGTGCATCTTTCCGAACGAGTGAACGAGTATCAGAGGTCCCTTATCCTTCGGCATCATAGTTTCGGCCATGTGCTCTGCCTGGGAGTGCACAATAAGCCATTTTTGGTTTTCACACCCATTAATTGTGCACATTTTTGCCCTGACCTGCCCTGACCGTTTACAGCTTTAATGCTGGTGGTTTGGTCCTACTACATA

Full Affymetrix probeset data:

Annotations for 1630354_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720