Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630358_at:

>probe:Drosophila_2:1630358_at:483:325; Interrogation_Position=2025; Antisense; GCGGGTACTACGTGAAGCCAAAGAA
>probe:Drosophila_2:1630358_at:360:211; Interrogation_Position=2045; Antisense; AAGAACGCAAACTGCTAGCTGCCAA
>probe:Drosophila_2:1630358_at:405:339; Interrogation_Position=2058; Antisense; GCTAGCTGCCAAACAGCGGGACGAA
>probe:Drosophila_2:1630358_at:361:107; Interrogation_Position=2111; Antisense; AGAAGGCCAGGTGCATTTTTCTCAC
>probe:Drosophila_2:1630358_at:116:649; Interrogation_Position=2132; Antisense; TCACCCTTTTCTCATCTGCAATAAA
>probe:Drosophila_2:1630358_at:374:623; Interrogation_Position=2157; Antisense; TGCGGCAGCAAACACAACACCATGT
>probe:Drosophila_2:1630358_at:146:189; Interrogation_Position=2172; Antisense; AACACCATGTGGATCGACAACAAGA
>probe:Drosophila_2:1630358_at:218:661; Interrogation_Position=2208; Antisense; TAACGCCCACAAAAACAATTCTCAA
>probe:Drosophila_2:1630358_at:701:607; Interrogation_Position=2252; Antisense; TGAGTAATTCGCATGCTAAGCAATG
>probe:Drosophila_2:1630358_at:357:361; Interrogation_Position=2271; Antisense; GCAATGTACTTTTAATGTTCGCTTT
>probe:Drosophila_2:1630358_at:97:395; Interrogation_Position=2300; Antisense; GAAATTAACACAGACTTTTGCTCAA
>probe:Drosophila_2:1630358_at:535:617; Interrogation_Position=2351; Antisense; TGCATATTATATCATCTAGGCCGTA
>probe:Drosophila_2:1630358_at:462:177; Interrogation_Position=2412; Antisense; AAACGTGCAGAGAGACGCGTGTACG
>probe:Drosophila_2:1630358_at:48:489; Interrogation_Position=2432; Antisense; GTACGTGTTGTTTTAACTCCAGCCG

Paste this into a BLAST search page for me
GCGGGTACTACGTGAAGCCAAAGAAAAGAACGCAAACTGCTAGCTGCCAAGCTAGCTGCCAAACAGCGGGACGAAAGAAGGCCAGGTGCATTTTTCTCACTCACCCTTTTCTCATCTGCAATAAATGCGGCAGCAAACACAACACCATGTAACACCATGTGGATCGACAACAAGATAACGCCCACAAAAACAATTCTCAATGAGTAATTCGCATGCTAAGCAATGGCAATGTACTTTTAATGTTCGCTTTGAAATTAACACAGACTTTTGCTCAATGCATATTATATCATCTAGGCCGTAAAACGTGCAGAGAGACGCGTGTACGGTACGTGTTGTTTTAACTCCAGCCG

Full Affymetrix probeset data:

Annotations for 1630358_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime