Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630359_at:

>probe:Drosophila_2:1630359_at:394:191; Interrogation_Position=1011; Antisense; AACTTTCTTAGGTTCCTAGCAGCCA
>probe:Drosophila_2:1630359_at:300:275; Interrogation_Position=1017; Antisense; CTTAGGTTCCTAGCAGCCATGTAAA
>probe:Drosophila_2:1630359_at:720:717; Interrogation_Position=1023; Antisense; TTCCTAGCAGCCATGTAAATATTTG
>probe:Drosophila_2:1630359_at:623:659; Interrogation_Position=1054; Antisense; TAAATACCTTAGAGTTTACGGCAGT
>probe:Drosophila_2:1630359_at:698:655; Interrogation_Position=1063; Antisense; TAGAGTTTACGGCAGTTTTTAACAG
>probe:Drosophila_2:1630359_at:317:667; Interrogation_Position=1070; Antisense; TACGGCAGTTTTTAACAGTGGAAAT
>probe:Drosophila_2:1630359_at:116:243; Interrogation_Position=1104; Antisense; AATTTTTGAGAATATGTTATGCTGA
>probe:Drosophila_2:1630359_at:170:667; Interrogation_Position=900; Antisense; TACAGTACGCCTTCATGAAGTTGGC
>probe:Drosophila_2:1630359_at:213:135; Interrogation_Position=906; Antisense; ACGCCTTCATGAAGTTGGCTCCCAT
>probe:Drosophila_2:1630359_at:422:55; Interrogation_Position=914; Antisense; ATGAAGTTGGCTCCCATGGATATTC
>probe:Drosophila_2:1630359_at:209:95; Interrogation_Position=918; Antisense; AGTTGGCTCCCATGGATATTCGTAC
>probe:Drosophila_2:1630359_at:653:583; Interrogation_Position=921; Antisense; TGGCTCCCATGGATATTCGTACTTA
>probe:Drosophila_2:1630359_at:597:543; Interrogation_Position=931; Antisense; GGATATTCGTACTTACTTCGGATAC
>probe:Drosophila_2:1630359_at:410:687; Interrogation_Position=934; Antisense; TATTCGTACTTACTTCGGATACCAA

Paste this into a BLAST search page for me
AACTTTCTTAGGTTCCTAGCAGCCACTTAGGTTCCTAGCAGCCATGTAAATTCCTAGCAGCCATGTAAATATTTGTAAATACCTTAGAGTTTACGGCAGTTAGAGTTTACGGCAGTTTTTAACAGTACGGCAGTTTTTAACAGTGGAAATAATTTTTGAGAATATGTTATGCTGATACAGTACGCCTTCATGAAGTTGGCACGCCTTCATGAAGTTGGCTCCCATATGAAGTTGGCTCCCATGGATATTCAGTTGGCTCCCATGGATATTCGTACTGGCTCCCATGGATATTCGTACTTAGGATATTCGTACTTACTTCGGATACTATTCGTACTTACTTCGGATACCAA

Full Affymetrix probeset data:

Annotations for 1630359_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime