Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630361_at:

>probe:Drosophila_2:1630361_at:147:687; Interrogation_Position=4357; Antisense; TATCACTATCAGAAACAACATGTTG
>probe:Drosophila_2:1630361_at:293:159; Interrogation_Position=4371; Antisense; ACAACATGTTGCCAAGAGCATTTTG
>probe:Drosophila_2:1630361_at:494:345; Interrogation_Position=4388; Antisense; GCATTTTGTGTTGCTGAGCGTGTAC
>probe:Drosophila_2:1630361_at:585:415; Interrogation_Position=4403; Antisense; GAGCGTGTACGTGTAAACTAATGGG
>probe:Drosophila_2:1630361_at:519:457; Interrogation_Position=4476; Antisense; GATATAAAGTTTTATGCGCCGCTTT
>probe:Drosophila_2:1630361_at:556:321; Interrogation_Position=4491; Antisense; GCGCCGCTTTTTACGTGTTTAGACA
>probe:Drosophila_2:1630361_at:456:465; Interrogation_Position=4529; Antisense; GATTGTAGTGGAACTATGGCCGCCA
>probe:Drosophila_2:1630361_at:365:679; Interrogation_Position=4543; Antisense; TATGGCCGCCAGTTTAAGTTAACTA
>probe:Drosophila_2:1630361_at:656:91; Interrogation_Position=4559; Antisense; AGTTAACTACCGATATGGATCATGT
>probe:Drosophila_2:1630361_at:67:483; Interrogation_Position=4582; Antisense; GTATATTTATGTTATCTAAGCCAAT
>probe:Drosophila_2:1630361_at:136:345; Interrogation_Position=4664; Antisense; GCAACTAAGTACTAAACCACAACGA
>probe:Drosophila_2:1630361_at:417:413; Interrogation_Position=4687; Antisense; GACCACCAACACAAATCGTAGTTCA
>probe:Drosophila_2:1630361_at:215:707; Interrogation_Position=4738; Antisense; TTACATCATCTGTCAAACAATCGAG
>probe:Drosophila_2:1630361_at:37:187; Interrogation_Position=4753; Antisense; AACAATCGAGTTACCAATCCAATCA

Paste this into a BLAST search page for me
TATCACTATCAGAAACAACATGTTGACAACATGTTGCCAAGAGCATTTTGGCATTTTGTGTTGCTGAGCGTGTACGAGCGTGTACGTGTAAACTAATGGGGATATAAAGTTTTATGCGCCGCTTTGCGCCGCTTTTTACGTGTTTAGACAGATTGTAGTGGAACTATGGCCGCCATATGGCCGCCAGTTTAAGTTAACTAAGTTAACTACCGATATGGATCATGTGTATATTTATGTTATCTAAGCCAATGCAACTAAGTACTAAACCACAACGAGACCACCAACACAAATCGTAGTTCATTACATCATCTGTCAAACAATCGAGAACAATCGAGTTACCAATCCAATCA

Full Affymetrix probeset data:

Annotations for 1630361_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime