FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630363_at:

>probe:Drosophila_2:1630363_at:656:321; Interrogation_Position=217; Antisense; GCCCATTGTCTGCAGGATCCAAAGT
>probe:Drosophila_2:1630363_at:520:559; Interrogation_Position=251; Antisense; GGAAAGTGCTGATCCACGTGGGAAA
>probe:Drosophila_2:1630363_at:486:395; Interrogation_Position=298; Antisense; GAAATCGTGGTCAACCGGAGCTACA
>probe:Drosophila_2:1630363_at:129:341; Interrogation_Position=317; Antisense; GCTACACCATCGTCCACAAGAAGTT
>probe:Drosophila_2:1630363_at:546:707; Interrogation_Position=401; Antisense; TTAACAAGTATATCCAACCCGCCAA
>probe:Drosophila_2:1630363_at:471:533; Interrogation_Position=454; Antisense; GGTCGCAAAGCCATCATTTCGGGTT
>probe:Drosophila_2:1630363_at:71:81; Interrogation_Position=509; Antisense; AGGTGCTCCAGTACATCAGGGCGCC
>probe:Drosophila_2:1630363_at:260:323; Interrogation_Position=529; Antisense; GCGCCCATCATCTCGAACAAGGAGT
>probe:Drosophila_2:1630363_at:337:183; Interrogation_Position=593; Antisense; AAAAGGTCGTGCACAACGGCTTCAT
>probe:Drosophila_2:1630363_at:673:141; Interrogation_Position=608; Antisense; ACGGCTTCATCTGCATCGATTCCAA
>probe:Drosophila_2:1630363_at:268:311; Interrogation_Position=629; Antisense; CCAAGAAGGGTCTGCCATGTCGCGG
>probe:Drosophila_2:1630363_at:62:727; Interrogation_Position=707; Antisense; TTGTATCCCACGGATTCGATGGCGA
>probe:Drosophila_2:1630363_at:108:511; Interrogation_Position=732; Antisense; GTGCAAGCTAAAACTGCCCGACGTA
>probe:Drosophila_2:1630363_at:713:477; Interrogation_Position=766; Antisense; GTTTCTTCCTACCTCAAGTGGATTA

Paste this into a BLAST search page for me
GCCCATTGTCTGCAGGATCCAAAGTGGAAAGTGCTGATCCACGTGGGAAAGAAATCGTGGTCAACCGGAGCTACAGCTACACCATCGTCCACAAGAAGTTTTAACAAGTATATCCAACCCGCCAAGGTCGCAAAGCCATCATTTCGGGTTAGGTGCTCCAGTACATCAGGGCGCCGCGCCCATCATCTCGAACAAGGAGTAAAAGGTCGTGCACAACGGCTTCATACGGCTTCATCTGCATCGATTCCAACCAAGAAGGGTCTGCCATGTCGCGGTTGTATCCCACGGATTCGATGGCGAGTGCAAGCTAAAACTGCCCGACGTAGTTTCTTCCTACCTCAAGTGGATTA

Full Affymetrix probeset data:

Annotations for 1630363_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720