Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630368_at:

>probe:Drosophila_2:1630368_at:523:207; Interrogation_Position=1648; Antisense; AAGCTACTGGCCAAGAACTTCTTCA
>probe:Drosophila_2:1630368_at:288:385; Interrogation_Position=1662; Antisense; GAACTTCTTCATGGACCTATGCGTA
>probe:Drosophila_2:1630368_at:698:399; Interrogation_Position=1703; Antisense; GACAGGCTCAGTCCGATCTGCATGG
>probe:Drosophila_2:1630368_at:265:93; Interrogation_Position=1756; Antisense; AGTTACCCGGTGAGCATCTGTGGAG
>probe:Drosophila_2:1630368_at:711:331; Interrogation_Position=1803; Antisense; GCTGTCGTTGCATTGGATCACCCAT
>probe:Drosophila_2:1630368_at:136:57; Interrogation_Position=1826; Antisense; ATGACCTTGACAGCGTAGACCACTT
>probe:Drosophila_2:1630368_at:540:289; Interrogation_Position=1839; Antisense; CGTAGACCACTTCGACGTTTTTGTG
>probe:Drosophila_2:1630368_at:465:591; Interrogation_Position=1860; Antisense; TGTGGACAACGTGCCAAACCGTAGT
>probe:Drosophila_2:1630368_at:709:201; Interrogation_Position=1876; Antisense; AACCGTAGTGTCTACAACCGGCAGG
>probe:Drosophila_2:1630368_at:579:513; Interrogation_Position=1984; Antisense; GGTCAGGATTCCTCGGTGGACAAAT
>probe:Drosophila_2:1630368_at:714:23; Interrogation_Position=2033; Antisense; ATATGCGTCACGTCAGGCAGGGCCA
>probe:Drosophila_2:1630368_at:461:709; Interrogation_Position=2106; Antisense; TTCACTGGTGGATTTCTGGACGGAC
>probe:Drosophila_2:1630368_at:651:399; Interrogation_Position=2128; Antisense; GACAGCGAGTTCTTGTACATGCCCA
>probe:Drosophila_2:1630368_at:240:323; Interrogation_Position=2156; Antisense; GCGAAACTCTTACGCCTTCAAAGGC

Paste this into a BLAST search page for me
AAGCTACTGGCCAAGAACTTCTTCAGAACTTCTTCATGGACCTATGCGTAGACAGGCTCAGTCCGATCTGCATGGAGTTACCCGGTGAGCATCTGTGGAGGCTGTCGTTGCATTGGATCACCCATATGACCTTGACAGCGTAGACCACTTCGTAGACCACTTCGACGTTTTTGTGTGTGGACAACGTGCCAAACCGTAGTAACCGTAGTGTCTACAACCGGCAGGGGTCAGGATTCCTCGGTGGACAAATATATGCGTCACGTCAGGCAGGGCCATTCACTGGTGGATTTCTGGACGGACGACAGCGAGTTCTTGTACATGCCCAGCGAAACTCTTACGCCTTCAAAGGC

Full Affymetrix probeset data:

Annotations for 1630368_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime