Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630370_at:

>probe:Drosophila_2:1630370_at:10:319; Interrogation_Position=1033; Antisense; GCCGTCCAATTATGCAGCTCGAATA
>probe:Drosophila_2:1630370_at:433:625; Interrogation_Position=538; Antisense; TGCGCCTCGGAGAACCACATCAATA
>probe:Drosophila_2:1630370_at:129:107; Interrogation_Position=569; Antisense; AGAACATCAAGACCTGTGCCAACTC
>probe:Drosophila_2:1630370_at:56:325; Interrogation_Position=626; Antisense; GCGAAAGCACCATGCGGCTCAAGGA
>probe:Drosophila_2:1630370_at:538:109; Interrogation_Position=698; Antisense; AGAAGGTGAATGATCGCGCCCAGGT
>probe:Drosophila_2:1630370_at:150:519; Interrogation_Position=730; Antisense; GTGGGCACCATCTGCCAATACGTAT
>probe:Drosophila_2:1630370_at:527:39; Interrogation_Position=772; Antisense; ATCTGCAACCAGCACAACGGAGCAT
>probe:Drosophila_2:1630370_at:487:405; Interrogation_Position=798; Antisense; GACTCCATCTTTGGCCAGCGTAAGC
>probe:Drosophila_2:1630370_at:145:621; Interrogation_Position=839; Antisense; TGCTGGGTCTTTGGTTTATCCGCTC
>probe:Drosophila_2:1630370_at:474:683; Interrogation_Position=855; Antisense; TATCCGCTCCTTCTACTAAGCTAAG
>probe:Drosophila_2:1630370_at:452:31; Interrogation_Position=920; Antisense; ATAACTCTTCCAAGTCAGCTCAAAC
>probe:Drosophila_2:1630370_at:436:337; Interrogation_Position=937; Antisense; GCTCAAACCTTTGGCAATCGGGAAT
>probe:Drosophila_2:1630370_at:514:525; Interrogation_Position=956; Antisense; GGGAATCTCAACACCTAATGCTGTA
>probe:Drosophila_2:1630370_at:699:51; Interrogation_Position=973; Antisense; ATGCTGTATTTTGCTCTTGACCTTT

Paste this into a BLAST search page for me
GCCGTCCAATTATGCAGCTCGAATATGCGCCTCGGAGAACCACATCAATAAGAACATCAAGACCTGTGCCAACTCGCGAAAGCACCATGCGGCTCAAGGAAGAAGGTGAATGATCGCGCCCAGGTGTGGGCACCATCTGCCAATACGTATATCTGCAACCAGCACAACGGAGCATGACTCCATCTTTGGCCAGCGTAAGCTGCTGGGTCTTTGGTTTATCCGCTCTATCCGCTCCTTCTACTAAGCTAAGATAACTCTTCCAAGTCAGCTCAAACGCTCAAACCTTTGGCAATCGGGAATGGGAATCTCAACACCTAATGCTGTAATGCTGTATTTTGCTCTTGACCTTT

Full Affymetrix probeset data:

Annotations for 1630370_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime