FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630373_at:

>probe:Drosophila_2:1630373_at:335:291; Interrogation_Position=538; Antisense; CGGTGGCAACCAACGAGAATCGCAT
>probe:Drosophila_2:1630373_at:4:321; Interrogation_Position=567; Antisense; GCCGCCTCCTTGGACGGATGTGTGA
>probe:Drosophila_2:1630373_at:407:517; Interrogation_Position=609; Antisense; GTGGGCGAACTTACCTGCGACAAAA
>probe:Drosophila_2:1630373_at:702:613; Interrogation_Position=638; Antisense; TGAACCCATCACATATCTGGCGCAG
>probe:Drosophila_2:1630373_at:487:111; Interrogation_Position=673; Antisense; AGCAATGTCTGGTGGCCGGCTGTCA
>probe:Drosophila_2:1630373_at:595:333; Interrogation_Position=691; Antisense; GCTGTCAGGATAGTGTGGTTCGTCT
>probe:Drosophila_2:1630373_at:480:287; Interrogation_Position=717; Antisense; CTGGACTGTGAGACCGGCGGATTAC
>probe:Drosophila_2:1630373_at:478:365; Interrogation_Position=790; Antisense; GAATACTGTCAAACGATGCCCAAAT
>probe:Drosophila_2:1630373_at:76:67; Interrogation_Position=832; Antisense; ATGGAGACGCCTTTGTTTACGACCT
>probe:Drosophila_2:1630373_at:358:137; Interrogation_Position=850; Antisense; ACGACCTGCTCGATGGGAAAGTACT
>probe:Drosophila_2:1630373_at:182:561; Interrogation_Position=865; Antisense; GGAAAGTACTGCAGCGCATTCGCAT
>probe:Drosophila_2:1630373_at:502:29; Interrogation_Position=888; Antisense; ATAAGTGATAATGGCGGCGTCGTCC
>probe:Drosophila_2:1630373_at:68:561; Interrogation_Position=941; Antisense; GGAAATGCTTTTCGCCAGACGACGG
>probe:Drosophila_2:1630373_at:26:529; Interrogation_Position=964; Antisense; GGGACATGTATGTCTTCTCGACAGA

Paste this into a BLAST search page for me
CGGTGGCAACCAACGAGAATCGCATGCCGCCTCCTTGGACGGATGTGTGAGTGGGCGAACTTACCTGCGACAAAATGAACCCATCACATATCTGGCGCAGAGCAATGTCTGGTGGCCGGCTGTCAGCTGTCAGGATAGTGTGGTTCGTCTCTGGACTGTGAGACCGGCGGATTACGAATACTGTCAAACGATGCCCAAATATGGAGACGCCTTTGTTTACGACCTACGACCTGCTCGATGGGAAAGTACTGGAAAGTACTGCAGCGCATTCGCATATAAGTGATAATGGCGGCGTCGTCCGGAAATGCTTTTCGCCAGACGACGGGGGACATGTATGTCTTCTCGACAGA

Full Affymetrix probeset data:

Annotations for 1630373_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720