FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630374_at:

>probe:Drosophila_2:1630374_at:417:521; Interrogation_Position=1006; Antisense; GTGGCTCTGGGTGAACTTCGCTATA
>probe:Drosophila_2:1630374_at:501:377; Interrogation_Position=1033; Antisense; GAAGCTGCGCTCTTGGAGGCACTGC
>probe:Drosophila_2:1630374_at:164:109; Interrogation_Position=1085; Antisense; AGAAGCGCTGCACCAAGACATTCAC
>probe:Drosophila_2:1630374_at:371:151; Interrogation_Position=1102; Antisense; ACATTCACCCTTCCTGATCAGAAAT
>probe:Drosophila_2:1630374_at:83:319; Interrogation_Position=1176; Antisense; GCCGGTTCAGGCCATTCATTTAGAT
>probe:Drosophila_2:1630374_at:119:699; Interrogation_Position=1194; Antisense; TTTAGATCCCGCATTGTATCCGGCA
>probe:Drosophila_2:1630374_at:285:253; Interrogation_Position=1221; Antisense; CAACCAGTTTCGTCCAGAACGCTTT
>probe:Drosophila_2:1630374_at:393:381; Interrogation_Position=1237; Antisense; GAACGCTTTCTAAATCAGCCACCAA
>probe:Drosophila_2:1630374_at:494:229; Interrogation_Position=1260; Antisense; AATGGGCTGTCGGTTTCTGGGCTTC
>probe:Drosophila_2:1630374_at:558:63; Interrogation_Position=1300; Antisense; ATGTGTCCGGGAATGCGACTTGGCC
>probe:Drosophila_2:1630374_at:164:105; Interrogation_Position=1331; Antisense; AGACGAAGGCTGCACTGACCACACT
>probe:Drosophila_2:1630374_at:534:77; Interrogation_Position=932; Antisense; AGGATGCACAGCGACGGTTACACAT
>probe:Drosophila_2:1630374_at:328:247; Interrogation_Position=959; Antisense; AATTGGATGAAGTGGCCCAGCGCCA
>probe:Drosophila_2:1630374_at:68:363; Interrogation_Position=989; Antisense; GCAATCTGATTGATCCAGTGGCTCT

Paste this into a BLAST search page for me
GTGGCTCTGGGTGAACTTCGCTATAGAAGCTGCGCTCTTGGAGGCACTGCAGAAGCGCTGCACCAAGACATTCACACATTCACCCTTCCTGATCAGAAATGCCGGTTCAGGCCATTCATTTAGATTTTAGATCCCGCATTGTATCCGGCACAACCAGTTTCGTCCAGAACGCTTTGAACGCTTTCTAAATCAGCCACCAAAATGGGCTGTCGGTTTCTGGGCTTCATGTGTCCGGGAATGCGACTTGGCCAGACGAAGGCTGCACTGACCACACTAGGATGCACAGCGACGGTTACACATAATTGGATGAAGTGGCCCAGCGCCAGCAATCTGATTGATCCAGTGGCTCT

Full Affymetrix probeset data:

Annotations for 1630374_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720