FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630375_at:

>probe:Drosophila_2:1630375_at:240:67; Interrogation_Position=1011; Antisense; ATGGAGCTGCTTACTCCGTATCTGG
>probe:Drosophila_2:1630375_at:706:639; Interrogation_Position=1031; Antisense; TCTGGCCAAATATGCCCACTTGATG
>probe:Drosophila_2:1630375_at:408:313; Interrogation_Position=1061; Antisense; GCCACCGGAACTTAAGCAATCGCCA
>probe:Drosophila_2:1630375_at:468:677; Interrogation_Position=1108; Antisense; TAGACGCACTGGACGCTTGGCCGAA
>probe:Drosophila_2:1630375_at:586:459; Interrogation_Position=1144; Antisense; GATTTGAATCTAGGGCGTTGCCAGA
>probe:Drosophila_2:1630375_at:660:53; Interrogation_Position=1216; Antisense; ATGCAATTCGCACTAGCTGGCAGCT
>probe:Drosophila_2:1630375_at:364:503; Interrogation_Position=674; Antisense; GTCCGAACTGCTAACCGAGCGCGAA
>probe:Drosophila_2:1630375_at:695:241; Interrogation_Position=711; Antisense; AATATGCAGGCCACGTTGGACGAGG
>probe:Drosophila_2:1630375_at:74:727; Interrogation_Position=769; Antisense; TTGAGATCAAGGATGTCTCCCTGCC
>probe:Drosophila_2:1630375_at:693:605; Interrogation_Position=839; Antisense; TGATGCTCGTGCCAAGGTGATCGCC
>probe:Drosophila_2:1630375_at:483:511; Interrogation_Position=871; Antisense; GTGAGAAGAAGTCCGCCACAGCGCT
>probe:Drosophila_2:1630375_at:291:77; Interrogation_Position=898; Antisense; AGGAGGCATCCGATGTCATTTCCGC
>probe:Drosophila_2:1630375_at:387:119; Interrogation_Position=940; Antisense; AGCTGCGCTACTTGCAAACCCTGAG
>probe:Drosophila_2:1630375_at:167:375; Interrogation_Position=980; Antisense; GAAGAACTCCACCATTATCTTTCCT

Paste this into a BLAST search page for me
ATGGAGCTGCTTACTCCGTATCTGGTCTGGCCAAATATGCCCACTTGATGGCCACCGGAACTTAAGCAATCGCCATAGACGCACTGGACGCTTGGCCGAAGATTTGAATCTAGGGCGTTGCCAGAATGCAATTCGCACTAGCTGGCAGCTGTCCGAACTGCTAACCGAGCGCGAAAATATGCAGGCCACGTTGGACGAGGTTGAGATCAAGGATGTCTCCCTGCCTGATGCTCGTGCCAAGGTGATCGCCGTGAGAAGAAGTCCGCCACAGCGCTAGGAGGCATCCGATGTCATTTCCGCAGCTGCGCTACTTGCAAACCCTGAGGAAGAACTCCACCATTATCTTTCCT

Full Affymetrix probeset data:

Annotations for 1630375_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720