FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630376_at:

>probe:Drosophila_2:1630376_at:71:195; Interrogation_Position=6013; Antisense; AACTGTATCTAGTCAAATTCTTAAG
>probe:Drosophila_2:1630376_at:227:181; Interrogation_Position=6044; Antisense; AAAAATCATTTACTCATTTCATACA
>probe:Drosophila_2:1630376_at:111:603; Interrogation_Position=6103; Antisense; TGTTATAATTAACTCATCCGCATTA
>probe:Drosophila_2:1630376_at:132:271; Interrogation_Position=6117; Antisense; CATCCGCATTAAAAAGGCCTATATT
>probe:Drosophila_2:1630376_at:647:1; Interrogation_Position=6131; Antisense; AGGCCTATATTGTACCTTAGTATTT
>probe:Drosophila_2:1630376_at:327:563; Interrogation_Position=6141; Antisense; TGTACCTTAGTATTTACCTTTTATG
>probe:Drosophila_2:1630376_at:161:635; Interrogation_Position=6286; Antisense; TCGAAAATCCTTCCAGTTAAGTTTG
>probe:Drosophila_2:1630376_at:256:47; Interrogation_Position=6292; Antisense; ATCCTTCCAGTTAAGTTTGAATGTA
>probe:Drosophila_2:1630376_at:281:29; Interrogation_Position=6344; Antisense; ATGAATCACCGTTAATTTTAGAATG
>probe:Drosophila_2:1630376_at:465:497; Interrogation_Position=6406; Antisense; GTCATTATGTTAATATCTCTAGGAA
>probe:Drosophila_2:1630376_at:374:531; Interrogation_Position=6457; Antisense; GGTGTATGCTAGTCAATTTAGTTTA
>probe:Drosophila_2:1630376_at:401:423; Interrogation_Position=6492; Antisense; TAGTAAACAGCGCATTAGTGAGGTG
>probe:Drosophila_2:1630376_at:550:511; Interrogation_Position=6509; Antisense; GTGAGGTGCGTATGTCTAGGCACAT
>probe:Drosophila_2:1630376_at:248:499; Interrogation_Position=6522; Antisense; GTCTAGGCACATTTTTAATTTAAGT

Paste this into a BLAST search page for me
AACTGTATCTAGTCAAATTCTTAAGAAAAATCATTTACTCATTTCATACATGTTATAATTAACTCATCCGCATTACATCCGCATTAAAAAGGCCTATATTAGGCCTATATTGTACCTTAGTATTTTGTACCTTAGTATTTACCTTTTATGTCGAAAATCCTTCCAGTTAAGTTTGATCCTTCCAGTTAAGTTTGAATGTAATGAATCACCGTTAATTTTAGAATGGTCATTATGTTAATATCTCTAGGAAGGTGTATGCTAGTCAATTTAGTTTATAGTAAACAGCGCATTAGTGAGGTGGTGAGGTGCGTATGTCTAGGCACATGTCTAGGCACATTTTTAATTTAAGT

Full Affymetrix probeset data:

Annotations for 1630376_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720