FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630377_at:

>probe:Drosophila_2:1630377_at:100:373; Interrogation_Position=1011; Antisense; GAAGGTGTCTCATTTGCCCAAGATC
>probe:Drosophila_2:1630377_at:618:291; Interrogation_Position=1073; Antisense; CGTCCGACTATATTCTCAACTACAG
>probe:Drosophila_2:1630377_at:454:311; Interrogation_Position=1106; Antisense; GCGTATCAGGGTTTTCTAGTCTCTC
>probe:Drosophila_2:1630377_at:88:679; Interrogation_Position=1122; Antisense; TAGTCTCTCCGACTGCAATGGAACG
>probe:Drosophila_2:1630377_at:398:513; Interrogation_Position=1198; Antisense; GTGTTTTTCGGAGCAATCTTCACAT
>probe:Drosophila_2:1630377_at:592:729; Interrogation_Position=673; Antisense; TTGGAACAGGGACTCATCGACGAAC
>probe:Drosophila_2:1630377_at:329:381; Interrogation_Position=723; Antisense; GAACGCCTCGGATGCCAGTAATGGT
>probe:Drosophila_2:1630377_at:110:657; Interrogation_Position=741; Antisense; TAATGGTGGCGTATTGCTGCTCGGA
>probe:Drosophila_2:1630377_at:552:549; Interrogation_Position=763; Antisense; GGAGGATCAGATCCCACTCTTTACA
>probe:Drosophila_2:1630377_at:627:399; Interrogation_Position=798; Antisense; GACATACGTGCCAGTTTCCAAAGTG
>probe:Drosophila_2:1630377_at:307:565; Interrogation_Position=830; Antisense; GGCAGATCACCGTGGGCCAAGTTGA
>probe:Drosophila_2:1630377_at:303:465; Interrogation_Position=855; Antisense; GATTGGGTCCAAGAAGCTGTGCTCC
>probe:Drosophila_2:1630377_at:100:195; Interrogation_Position=880; Antisense; AACTGCCAGGCCATCTTCGATATGG
>probe:Drosophila_2:1630377_at:94:203; Interrogation_Position=906; Antisense; AACCTCCTTGATAATTGTGCCGTGC

Paste this into a BLAST search page for me
GAAGGTGTCTCATTTGCCCAAGATCCGTCCGACTATATTCTCAACTACAGGCGTATCAGGGTTTTCTAGTCTCTCTAGTCTCTCCGACTGCAATGGAACGGTGTTTTTCGGAGCAATCTTCACATTTGGAACAGGGACTCATCGACGAACGAACGCCTCGGATGCCAGTAATGGTTAATGGTGGCGTATTGCTGCTCGGAGGAGGATCAGATCCCACTCTTTACAGACATACGTGCCAGTTTCCAAAGTGGGCAGATCACCGTGGGCCAAGTTGAGATTGGGTCCAAGAAGCTGTGCTCCAACTGCCAGGCCATCTTCGATATGGAACCTCCTTGATAATTGTGCCGTGC

Full Affymetrix probeset data:

Annotations for 1630377_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720