Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630378_at:

>probe:Drosophila_2:1630378_at:470:15; Interrogation_Position=3037; Antisense; ATTTCAACCCCATTACGACCAATGT
>probe:Drosophila_2:1630378_at:359:699; Interrogation_Position=3049; Antisense; TTACGACCAATGTGACTAAGCCGCC
>probe:Drosophila_2:1630378_at:10:321; Interrogation_Position=3071; Antisense; GCCCATCCGACGACGCGAGGAAGAA
>probe:Drosophila_2:1630378_at:404:639; Interrogation_Position=3135; Antisense; TCGTCGTCCATCAAGGTGGTCCACT
>probe:Drosophila_2:1630378_at:293:259; Interrogation_Position=3156; Antisense; CACTTCGGCGTGGTCTAATAATTCA
>probe:Drosophila_2:1630378_at:216:13; Interrogation_Position=3176; Antisense; ATTCATAGTGCAATTCCCAGGCGTA
>probe:Drosophila_2:1630378_at:491:1; Interrogation_Position=3194; Antisense; AGGCGTACACCACACAACGGTTAAG
>probe:Drosophila_2:1630378_at:646:195; Interrogation_Position=3209; Antisense; AACGGTTAAGCGCTGCGTCTTCCAA
>probe:Drosophila_2:1630378_at:393:327; Interrogation_Position=3223; Antisense; GCGTCTTCCAATCGTTTGTAACTAT
>probe:Drosophila_2:1630378_at:532:535; Interrogation_Position=3508; Antisense; GGCTAAACTATTGCCGTCCCAGTTA
>probe:Drosophila_2:1630378_at:59:319; Interrogation_Position=3520; Antisense; GCCGTCCCAGTTAGTGCAAAGCTTT
>probe:Drosophila_2:1630378_at:358:1; Interrogation_Position=3552; Antisense; AAAGTTTTACTCATAGGTTCTCTAT
>probe:Drosophila_2:1630378_at:75:541; Interrogation_Position=3567; Antisense; GGTTCTCTATACTCTTTACACAGGT
>probe:Drosophila_2:1630378_at:298:257; Interrogation_Position=3585; Antisense; CACAGGTTACTCATTAAAGCTAAGC

Paste this into a BLAST search page for me
ATTTCAACCCCATTACGACCAATGTTTACGACCAATGTGACTAAGCCGCCGCCCATCCGACGACGCGAGGAAGAATCGTCGTCCATCAAGGTGGTCCACTCACTTCGGCGTGGTCTAATAATTCAATTCATAGTGCAATTCCCAGGCGTAAGGCGTACACCACACAACGGTTAAGAACGGTTAAGCGCTGCGTCTTCCAAGCGTCTTCCAATCGTTTGTAACTATGGCTAAACTATTGCCGTCCCAGTTAGCCGTCCCAGTTAGTGCAAAGCTTTAAAGTTTTACTCATAGGTTCTCTATGGTTCTCTATACTCTTTACACAGGTCACAGGTTACTCATTAAAGCTAAGC

Full Affymetrix probeset data:

Annotations for 1630378_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime