Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630379_s_at:

>probe:Drosophila_2:1630379_s_at:527:263; Interrogation_Position=100; Antisense; CAGCTGGAGCACAAGTTGGATAAAA
>probe:Drosophila_2:1630379_s_at:147:545; Interrogation_Position=117; Antisense; GGATAAAATCTTGCAGAAGCGCACT
>probe:Drosophila_2:1630379_s_at:142:239; Interrogation_Position=123; Antisense; AATCTTGCAGAAGCGCACTGAGCTC
>probe:Drosophila_2:1630379_s_at:322:711; Interrogation_Position=127; Antisense; TTGCAGAAGCGCACTGAGCTCGACA
>probe:Drosophila_2:1630379_s_at:603:263; Interrogation_Position=130; Antisense; CAGAAGCGCACTGAGCTCGACAAGT
>probe:Drosophila_2:1630379_s_at:281:379; Interrogation_Position=132; Antisense; GAAGCGCACTGAGCTCGACAAGTCG
>probe:Drosophila_2:1630379_s_at:29:123; Interrogation_Position=134; Antisense; AGCGCACTGAGCTCGACAAGTCGGT
>probe:Drosophila_2:1630379_s_at:246:257; Interrogation_Position=138; Antisense; CACTGAGCTCGACAAGTCGGTGCGC
>probe:Drosophila_2:1630379_s_at:718:117; Interrogation_Position=143; Antisense; AGCTCGACAAGTCGGTGCGCCACAA
>probe:Drosophila_2:1630379_s_at:54:637; Interrogation_Position=146; Antisense; TCGACAAGTCGGTGCGCCACAAGAG
>probe:Drosophila_2:1630379_s_at:680:295; Interrogation_Position=147; Antisense; CGACAAGTCGGTGCGCCACAAGAGC
>probe:Drosophila_2:1630379_s_at:368:161; Interrogation_Position=164; Antisense; ACAAGAGCCGCCAAAAGTACCAGGA
>probe:Drosophila_2:1630379_s_at:727:415; Interrogation_Position=168; Antisense; GAGCCGCCAAAAGTACCAGGAGTTC
>probe:Drosophila_2:1630379_s_at:693:301; Interrogation_Position=171; Antisense; CCGCCAAAAGTACCAGGAGTTCCTG

Paste this into a BLAST search page for me
CAGCTGGAGCACAAGTTGGATAAAAGGATAAAATCTTGCAGAAGCGCACTAATCTTGCAGAAGCGCACTGAGCTCTTGCAGAAGCGCACTGAGCTCGACACAGAAGCGCACTGAGCTCGACAAGTGAAGCGCACTGAGCTCGACAAGTCGAGCGCACTGAGCTCGACAAGTCGGTCACTGAGCTCGACAAGTCGGTGCGCAGCTCGACAAGTCGGTGCGCCACAATCGACAAGTCGGTGCGCCACAAGAGCGACAAGTCGGTGCGCCACAAGAGCACAAGAGCCGCCAAAAGTACCAGGAGAGCCGCCAAAAGTACCAGGAGTTCCCGCCAAAAGTACCAGGAGTTCCTG

Full Affymetrix probeset data:

Annotations for 1630379_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime