FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630380_at:

>probe:Drosophila_2:1630380_at:207:627; Interrogation_Position=2671; Antisense; TGCCTCTCCCAGTTGGAGCCGGAAA
>probe:Drosophila_2:1630380_at:543:559; Interrogation_Position=2691; Antisense; GGAAACCCATTACCGGATCACCATA
>probe:Drosophila_2:1630380_at:563:261; Interrogation_Position=2709; Antisense; CACCATACGGGCTTGCGTCGAGGGC
>probe:Drosophila_2:1630380_at:137:83; Interrogation_Position=2729; Antisense; AGGGCGTGGTCAACGGATGCTCAAC
>probe:Drosophila_2:1630380_at:188:145; Interrogation_Position=2752; Antisense; ACTCCGGCGGAAGCTGTAATCAAGA
>probe:Drosophila_2:1630380_at:386:103; Interrogation_Position=2774; Antisense; AGACTGCAAGCATCCAACTGGAGCG
>probe:Drosophila_2:1630380_at:154:417; Interrogation_Position=2794; Antisense; GAGCGATTCATCAAGGGTGTTTAGC
>probe:Drosophila_2:1630380_at:365:235; Interrogation_Position=2823; Antisense; AATCCTCGATCGCAGACTTTCTGTA
>probe:Drosophila_2:1630380_at:613:403; Interrogation_Position=2837; Antisense; GACTTTCTGTATCCGCTGACAAGTG
>probe:Drosophila_2:1630380_at:1:341; Interrogation_Position=2868; Antisense; GCTAGACCCATATGACGATAGGCAT
>probe:Drosophila_2:1630380_at:227:23; Interrogation_Position=2976; Antisense; ATAGAAGGACCGCTGGACCTCTTAT
>probe:Drosophila_2:1630380_at:242:555; Interrogation_Position=2990; Antisense; GGACCTCTTATTTTTCCAGACTATA
>probe:Drosophila_2:1630380_at:102:493; Interrogation_Position=3146; Antisense; GTAAGCCGTGTCATATGGGCCCAAC
>probe:Drosophila_2:1630380_at:247:495; Interrogation_Position=3183; Antisense; GTCAAGTGACTGTAGTTCCTCCAAA

Paste this into a BLAST search page for me
TGCCTCTCCCAGTTGGAGCCGGAAAGGAAACCCATTACCGGATCACCATACACCATACGGGCTTGCGTCGAGGGCAGGGCGTGGTCAACGGATGCTCAACACTCCGGCGGAAGCTGTAATCAAGAAGACTGCAAGCATCCAACTGGAGCGGAGCGATTCATCAAGGGTGTTTAGCAATCCTCGATCGCAGACTTTCTGTAGACTTTCTGTATCCGCTGACAAGTGGCTAGACCCATATGACGATAGGCATATAGAAGGACCGCTGGACCTCTTATGGACCTCTTATTTTTCCAGACTATAGTAAGCCGTGTCATATGGGCCCAACGTCAAGTGACTGTAGTTCCTCCAAA

Full Affymetrix probeset data:

Annotations for 1630380_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720