FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630381_at:

>probe:Drosophila_2:1630381_at:696:419; Interrogation_Position=328; Antisense; GAGCAAACTCCAGATCTTGGCCAGA
>probe:Drosophila_2:1630381_at:370:463; Interrogation_Position=380; Antisense; GATTCTGGCACAAGCGAACGGCGGC
>probe:Drosophila_2:1630381_at:456:495; Interrogation_Position=406; Antisense; GTCACAGCATGTTGGCAGCAGAGCA
>probe:Drosophila_2:1630381_at:598:561; Interrogation_Position=437; Antisense; GGAAGCGCCGCTTCAAAACCGGATG
>probe:Drosophila_2:1630381_at:708:53; Interrogation_Position=459; Antisense; ATGCAGTCACTGTGGTGCAACCGGC
>probe:Drosophila_2:1630381_at:371:37; Interrogation_Position=544; Antisense; ATCATCATGGGCGTCTTTCTGCTCT
>probe:Drosophila_2:1630381_at:362:625; Interrogation_Position=575; Antisense; TGCCCTTCTTTCTGTGGTATGTCAT
>probe:Drosophila_2:1630381_at:365:293; Interrogation_Position=633; Antisense; CGATGTGCTCGTGGTGGTGTTATTC
>probe:Drosophila_2:1630381_at:489:513; Interrogation_Position=649; Antisense; GTGTTATTCTGGATCGGTTACTTCA
>probe:Drosophila_2:1630381_at:548:517; Interrogation_Position=664; Antisense; GGTTACTTCAACTCCACGCTAAATC
>probe:Drosophila_2:1630381_at:41:165; Interrogation_Position=684; Antisense; AAATCCGCTTATATACGCCTACTTT
>probe:Drosophila_2:1630381_at:179:17; Interrogation_Position=716; Antisense; ATTTTCGCGAGGCATTCCGCAATAC
>probe:Drosophila_2:1630381_at:203:241; Interrogation_Position=736; Antisense; AATACGCTGGAGTGTGTGCTGCCCT
>probe:Drosophila_2:1630381_at:639:507; Interrogation_Position=751; Antisense; GTGCTGCCCTGTCTGGAGAAACGAA

Paste this into a BLAST search page for me
GAGCAAACTCCAGATCTTGGCCAGAGATTCTGGCACAAGCGAACGGCGGCGTCACAGCATGTTGGCAGCAGAGCAGGAAGCGCCGCTTCAAAACCGGATGATGCAGTCACTGTGGTGCAACCGGCATCATCATGGGCGTCTTTCTGCTCTTGCCCTTCTTTCTGTGGTATGTCATCGATGTGCTCGTGGTGGTGTTATTCGTGTTATTCTGGATCGGTTACTTCAGGTTACTTCAACTCCACGCTAAATCAAATCCGCTTATATACGCCTACTTTATTTTCGCGAGGCATTCCGCAATACAATACGCTGGAGTGTGTGCTGCCCTGTGCTGCCCTGTCTGGAGAAACGAA

Full Affymetrix probeset data:

Annotations for 1630381_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720