Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630384_at:

>probe:Drosophila_2:1630384_at:572:69; Interrogation_Position=1392; Antisense; AGGCCAATGGTGTTCATGCCGTTCA
>probe:Drosophila_2:1630384_at:243:319; Interrogation_Position=1409; Antisense; GCCGTTCAGCATTTAGCGCACTTGA
>probe:Drosophila_2:1630384_at:628:629; Interrogation_Position=1495; Antisense; TCCAGTTCTCGTGCTCAGTGAAGGG
>probe:Drosophila_2:1630384_at:512:417; Interrogation_Position=1534; Antisense; GAGCGATTTTGTGCTGCCCATTAAT
>probe:Drosophila_2:1630384_at:620:623; Interrogation_Position=1558; Antisense; TGCCGATTCTAAGGCCGTGGAACTT
>probe:Drosophila_2:1630384_at:172:445; Interrogation_Position=1586; Antisense; GATGAATCTCTAAAGGCAGCCCACC
>probe:Drosophila_2:1630384_at:439:499; Interrogation_Position=1629; Antisense; GTCTGCAGCAGTTTCGCAAGTACTT
>probe:Drosophila_2:1630384_at:468:355; Interrogation_Position=1665; Antisense; GCACTAGCGGCTTCAACGTGAGCGA
>probe:Drosophila_2:1630384_at:134:605; Interrogation_Position=1759; Antisense; TGATCTGCATGGATTGCTGGTCCTC
>probe:Drosophila_2:1630384_at:497:67; Interrogation_Position=1834; Antisense; ATGGCAGCTGGCTACGGAGTTCGAA
>probe:Drosophila_2:1630384_at:236:377; Interrogation_Position=1856; Antisense; GAAGCAAAGCGTCGCCAGCGTATTC
>probe:Drosophila_2:1630384_at:605:261; Interrogation_Position=1871; Antisense; CAGCGTATTCAATCTCTGCCGAAAT
>probe:Drosophila_2:1630384_at:280:37; Interrogation_Position=1894; Antisense; ATCATCTGCCCAATTGCGCAATTAA
>probe:Drosophila_2:1630384_at:705:433; Interrogation_Position=1919; Antisense; GAGGGCCTCTCTTTTATACCATTTA

Paste this into a BLAST search page for me
AGGCCAATGGTGTTCATGCCGTTCAGCCGTTCAGCATTTAGCGCACTTGATCCAGTTCTCGTGCTCAGTGAAGGGGAGCGATTTTGTGCTGCCCATTAATTGCCGATTCTAAGGCCGTGGAACTTGATGAATCTCTAAAGGCAGCCCACCGTCTGCAGCAGTTTCGCAAGTACTTGCACTAGCGGCTTCAACGTGAGCGATGATCTGCATGGATTGCTGGTCCTCATGGCAGCTGGCTACGGAGTTCGAAGAAGCAAAGCGTCGCCAGCGTATTCCAGCGTATTCAATCTCTGCCGAAATATCATCTGCCCAATTGCGCAATTAAGAGGGCCTCTCTTTTATACCATTTA

Full Affymetrix probeset data:

Annotations for 1630384_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime