Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630386_at:

>probe:Drosophila_2:1630386_at:330:345; Interrogation_Position=1455; Antisense; GCATTCGGAATAAAGTGGGTCTCAC
>probe:Drosophila_2:1630386_at:380:713; Interrogation_Position=1458; Antisense; TTCGGAATAAAGTGGGTCTCACCTA
>probe:Drosophila_2:1630386_at:453:355; Interrogation_Position=1462; Antisense; GAATAAAGTGGGTCTCACCTATTAC
>probe:Drosophila_2:1630386_at:152:637; Interrogation_Position=1492; Antisense; TCGACATTTTACTAACCCGCTTGAT
>probe:Drosophila_2:1630386_at:145:297; Interrogation_Position=1493; Antisense; CGACATTTTACTAACCCGCTTGATG
>probe:Drosophila_2:1630386_at:94:147; Interrogation_Position=1495; Antisense; ACATTTTACTAACCCGCTTGATGTT
>probe:Drosophila_2:1630386_at:226:641; Interrogation_Position=1499; Antisense; TTTACTAACCCGCTTGATGTTTACA
>probe:Drosophila_2:1630386_at:277:667; Interrogation_Position=1501; Antisense; TACTAACCCGCTTGATGTTTACAGG
>probe:Drosophila_2:1630386_at:323:277; Interrogation_Position=1503; Antisense; CTAACCCGCTTGATGTTTACAGGAT
>probe:Drosophila_2:1630386_at:548:201; Interrogation_Position=1505; Antisense; AACCCGCTTGATGTTTACAGGATCG
>probe:Drosophila_2:1630386_at:659:299; Interrogation_Position=1507; Antisense; CCCGCTTGATGTTTACAGGATCGAC
>probe:Drosophila_2:1630386_at:619:341; Interrogation_Position=1510; Antisense; GCTTGATGTTTACAGGATCGACCAT
>probe:Drosophila_2:1630386_at:446:441; Interrogation_Position=1514; Antisense; GATGTTTACAGGATCGACCATCGAT
>probe:Drosophila_2:1630386_at:41:59; Interrogation_Position=1515; Antisense; ATGTTTACAGGATCGACCATCGATT

Paste this into a BLAST search page for me
GCATTCGGAATAAAGTGGGTCTCACTTCGGAATAAAGTGGGTCTCACCTAGAATAAAGTGGGTCTCACCTATTACTCGACATTTTACTAACCCGCTTGATCGACATTTTACTAACCCGCTTGATGACATTTTACTAACCCGCTTGATGTTTTTACTAACCCGCTTGATGTTTACATACTAACCCGCTTGATGTTTACAGGCTAACCCGCTTGATGTTTACAGGATAACCCGCTTGATGTTTACAGGATCGCCCGCTTGATGTTTACAGGATCGACGCTTGATGTTTACAGGATCGACCATGATGTTTACAGGATCGACCATCGATATGTTTACAGGATCGACCATCGATT

Full Affymetrix probeset data:

Annotations for 1630386_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime