FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630387_at:

>probe:Drosophila_2:1630387_at:436:557; Interrogation_Position=103; Antisense; GGACTTATCCAGATCGACTCGAGTT
>probe:Drosophila_2:1630387_at:557:387; Interrogation_Position=167; Antisense; GAAAACCTCGTCAGGCCTATAGTGC
>probe:Drosophila_2:1630387_at:234:25; Interrogation_Position=185; Antisense; ATAGTGCCTCACAGCTGGAACGTCT
>probe:Drosophila_2:1630387_at:371:23; Interrogation_Position=234; Antisense; ATATCTTAGCGTTAGCAAGCGTGTT
>probe:Drosophila_2:1630387_at:364:685; Interrogation_Position=275; Antisense; TATCTCTGACGGAAGTTCAGCGCGC
>probe:Drosophila_2:1630387_at:283:721; Interrogation_Position=310; Antisense; TTGTCGTCCTTCGTTCAACGCGAGG
>probe:Drosophila_2:1630387_at:209:327; Interrogation_Position=329; Antisense; GCGAGGTCCTTGTCACTTGCAGTGA
>probe:Drosophila_2:1630387_at:475:513; Interrogation_Position=350; Antisense; GTGATCAACCACATACTACCGTTTC
>probe:Drosophila_2:1630387_at:239:321; Interrogation_Position=402; Antisense; GCTCCCTTTGTGCTCGTTCAAAGTT
>probe:Drosophila_2:1630387_at:503:649; Interrogation_Position=419; Antisense; TCAAAGTTCGCACTATTACCGTTCG
>probe:Drosophila_2:1630387_at:688:285; Interrogation_Position=477; Antisense; CGGACCGGGAAATCTGCGCCAGGTA
>probe:Drosophila_2:1630387_at:300:557; Interrogation_Position=532; Antisense; GGACTTTGTGATTACTGGGCCAACA
>probe:Drosophila_2:1630387_at:451:695; Interrogation_Position=63; Antisense; TTTACCGAAATCACTGCTCTCATAC
>probe:Drosophila_2:1630387_at:465:557; Interrogation_Position=88; Antisense; GGACACGACGGACACGGACTTATCC

Paste this into a BLAST search page for me
GGACTTATCCAGATCGACTCGAGTTGAAAACCTCGTCAGGCCTATAGTGCATAGTGCCTCACAGCTGGAACGTCTATATCTTAGCGTTAGCAAGCGTGTTTATCTCTGACGGAAGTTCAGCGCGCTTGTCGTCCTTCGTTCAACGCGAGGGCGAGGTCCTTGTCACTTGCAGTGAGTGATCAACCACATACTACCGTTTCGCTCCCTTTGTGCTCGTTCAAAGTTTCAAAGTTCGCACTATTACCGTTCGCGGACCGGGAAATCTGCGCCAGGTAGGACTTTGTGATTACTGGGCCAACATTTACCGAAATCACTGCTCTCATACGGACACGACGGACACGGACTTATCC

Full Affymetrix probeset data:

Annotations for 1630387_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720