FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630388_at:

>probe:Drosophila_2:1630388_at:55:381; Interrogation_Position=119; Antisense; GAACCCAAAGGTAAATGCGGCGCTA
>probe:Drosophila_2:1630388_at:169:53; Interrogation_Position=133; Antisense; ATGCGGCGCTACCATCAAGAAACAG
>probe:Drosophila_2:1630388_at:56:171; Interrogation_Position=14; Antisense; AAAGTCCCTGTGTCTCGATTTCGGT
>probe:Drosophila_2:1630388_at:429:725; Interrogation_Position=174; Antisense; TTGAGCAGAAGAACCCGCTGAACTT
>probe:Drosophila_2:1630388_at:577:383; Interrogation_Position=221; Antisense; GAACTCGTCGTGCATTGGACTCGTA
>probe:Drosophila_2:1630388_at:81:217; Interrogation_Position=253; Antisense; AAGTACTCAGTCTCCCATCAAATTG
>probe:Drosophila_2:1630388_at:128:163; Interrogation_Position=272; Antisense; AAATTGCTGCCTCCTTGGTAGTTGT
>probe:Drosophila_2:1630388_at:366:537; Interrogation_Position=288; Antisense; GGTAGTTGTGTGTATCGCGCATAAA
>probe:Drosophila_2:1630388_at:512:689; Interrogation_Position=313; Antisense; TATTCTGTTTATCATGCTCTCTCGG
>probe:Drosophila_2:1630388_at:673:51; Interrogation_Position=326; Antisense; ATGCTCTCTCGGAATCATGGTCGTA
>probe:Drosophila_2:1630388_at:53:537; Interrogation_Position=36; Antisense; GGTCAAACAAAATGCCCCGTCGAGT
>probe:Drosophila_2:1630388_at:366:609; Interrogation_Position=48; Antisense; TGCCCCGTCGAGTACTGGAAACCTA
>probe:Drosophila_2:1630388_at:117:387; Interrogation_Position=65; Antisense; GAAACCTACGGATTTGAACCAGCCA
>probe:Drosophila_2:1630388_at:713:261; Interrogation_Position=92; Antisense; CAGCCATGTCTTCGCAAGTCAAAAT

Paste this into a BLAST search page for me
GAACCCAAAGGTAAATGCGGCGCTAATGCGGCGCTACCATCAAGAAACAGAAAGTCCCTGTGTCTCGATTTCGGTTTGAGCAGAAGAACCCGCTGAACTTGAACTCGTCGTGCATTGGACTCGTAAAGTACTCAGTCTCCCATCAAATTGAAATTGCTGCCTCCTTGGTAGTTGTGGTAGTTGTGTGTATCGCGCATAAATATTCTGTTTATCATGCTCTCTCGGATGCTCTCTCGGAATCATGGTCGTAGGTCAAACAAAATGCCCCGTCGAGTTGCCCCGTCGAGTACTGGAAACCTAGAAACCTACGGATTTGAACCAGCCACAGCCATGTCTTCGCAAGTCAAAAT

Full Affymetrix probeset data:

Annotations for 1630388_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720