FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630389_at:

>probe:Drosophila_2:1630389_at:469:151; Interrogation_Position=322; Antisense; ACATTTCGGCACTTGGAGGCGATCA
>probe:Drosophila_2:1630389_at:31:255; Interrogation_Position=345; Antisense; CAACAGGTTGTATCCGGATGCCAAA
>probe:Drosophila_2:1630389_at:607:155; Interrogation_Position=398; Antisense; ACACGCTGCTGGACTTTTGGAATGC
>probe:Drosophila_2:1630389_at:584:317; Interrogation_Position=466; Antisense; GCCTGGCTGCAGTGCTTTAACACAA
>probe:Drosophila_2:1630389_at:319:45; Interrogation_Position=495; Antisense; ATCGCTTTTGATTCGCATGGGCTTT
>probe:Drosophila_2:1630389_at:681:711; Interrogation_Position=518; Antisense; TTCAGGCCATGGACGGTAGTTTCAT
>probe:Drosophila_2:1630389_at:443:365; Interrogation_Position=571; Antisense; GAATACGTTGAGTCAGCCGGCGATA
>probe:Drosophila_2:1630389_at:507:581; Interrogation_Position=662; Antisense; TGGCCGCTCAGCTGAACATAAATCC
>probe:Drosophila_2:1630389_at:291:171; Interrogation_Position=692; Antisense; AAAGTGAGGATCTGCAGCCCATCAA
>probe:Drosophila_2:1630389_at:719:69; Interrogation_Position=746; Antisense; AGGCCTTCGGCAATGTGCTTTTCAA
>probe:Drosophila_2:1630389_at:299:623; Interrogation_Position=796; Antisense; TGCGAGTTTGTACAGCTGCAGCCCA
>probe:Drosophila_2:1630389_at:155:151; Interrogation_Position=823; Antisense; ACATCGGCATCGTCCTCGGAAAAGG
>probe:Drosophila_2:1630389_at:412:387; Interrogation_Position=841; Antisense; GAAAAGGTGGCGACGTCCATGTCCC
>probe:Drosophila_2:1630389_at:185:529; Interrogation_Position=867; Antisense; GGGAGGATCCTTGCTGAACCAGAAC

Paste this into a BLAST search page for me
ACATTTCGGCACTTGGAGGCGATCACAACAGGTTGTATCCGGATGCCAAAACACGCTGCTGGACTTTTGGAATGCGCCTGGCTGCAGTGCTTTAACACAAATCGCTTTTGATTCGCATGGGCTTTTTCAGGCCATGGACGGTAGTTTCATGAATACGTTGAGTCAGCCGGCGATATGGCCGCTCAGCTGAACATAAATCCAAAGTGAGGATCTGCAGCCCATCAAAGGCCTTCGGCAATGTGCTTTTCAATGCGAGTTTGTACAGCTGCAGCCCAACATCGGCATCGTCCTCGGAAAAGGGAAAAGGTGGCGACGTCCATGTCCCGGGAGGATCCTTGCTGAACCAGAAC

Full Affymetrix probeset data:

Annotations for 1630389_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720