FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630392_at:

>probe:Drosophila_2:1630392_at:258:723; Interrogation_Position=1064; Antisense; TTGTAGTAGTGCTGTTCCTGAACCC
>probe:Drosophila_2:1630392_at:225:345; Interrogation_Position=1094; Antisense; GCATTCTTTTCTACTCAGGCAGGAT
>probe:Drosophila_2:1630392_at:498:349; Interrogation_Position=1112; Antisense; GCAGGATCTGGCTATTGACCGTCAT
>probe:Drosophila_2:1630392_at:184:713; Interrogation_Position=1159; Antisense; TTCTTCTTTGTGAACTTCGCGGACT
>probe:Drosophila_2:1630392_at:404:83; Interrogation_Position=1199; Antisense; AGTGGACATCACTGGTGGTCACCAT
>probe:Drosophila_2:1630392_at:216:519; Interrogation_Position=1225; Antisense; GTGGATCACTATTACCTAGTCCGCT
>probe:Drosophila_2:1630392_at:231:679; Interrogation_Position=1241; Antisense; TAGTCCGCTTCTATGTGCGATACTT
>probe:Drosophila_2:1630392_at:202:457; Interrogation_Position=1259; Antisense; GATACTTCCTGGATCGGAGCGATGC
>probe:Drosophila_2:1630392_at:549:47; Interrogation_Position=1280; Antisense; ATGCCTTCGAGTTTGAGCCCGATTA
>probe:Drosophila_2:1630392_at:28:669; Interrogation_Position=1303; Antisense; TACGCGGTGGCTTGGTTTTACTACT
>probe:Drosophila_2:1630392_at:150:451; Interrogation_Position=1332; Antisense; GATCGTGGAGAATACCCTGCTTCGG
>probe:Drosophila_2:1630392_at:474:543; Interrogation_Position=1364; Antisense; GGATATTGGAGTTTGCCCTGGTCCA
>probe:Drosophila_2:1630392_at:1:461; Interrogation_Position=1451; Antisense; GATTTTTCTGGAACTTTCTGCGCCT
>probe:Drosophila_2:1630392_at:559:103; Interrogation_Position=1510; Antisense; AGAGCCACGCGGGACATCTTCATAA

Paste this into a BLAST search page for me
TTGTAGTAGTGCTGTTCCTGAACCCGCATTCTTTTCTACTCAGGCAGGATGCAGGATCTGGCTATTGACCGTCATTTCTTCTTTGTGAACTTCGCGGACTAGTGGACATCACTGGTGGTCACCATGTGGATCACTATTACCTAGTCCGCTTAGTCCGCTTCTATGTGCGATACTTGATACTTCCTGGATCGGAGCGATGCATGCCTTCGAGTTTGAGCCCGATTATACGCGGTGGCTTGGTTTTACTACTGATCGTGGAGAATACCCTGCTTCGGGGATATTGGAGTTTGCCCTGGTCCAGATTTTTCTGGAACTTTCTGCGCCTAGAGCCACGCGGGACATCTTCATAA

Full Affymetrix probeset data:

Annotations for 1630392_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720