FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630395_at:

>probe:Drosophila_2:1630395_at:548:555; Interrogation_Position=1006; Antisense; GGACGCCTTCAATATGGTCGGCTGT
>probe:Drosophila_2:1630395_at:413:547; Interrogation_Position=1036; Antisense; GGATGTGATACCCTACGATTCGATT
>probe:Drosophila_2:1630395_at:364:9; Interrogation_Position=1058; Antisense; ATTCCAGCGCGCGAAGCCAAGGTAT
>probe:Drosophila_2:1630395_at:211:29; Interrogation_Position=1081; Antisense; ATACAGTCCCATGTTCGACTACGTG
>probe:Drosophila_2:1630395_at:85:77; Interrogation_Position=621; Antisense; AGGAGCACATCCATTCGTCGGAGAT
>probe:Drosophila_2:1630395_at:523:453; Interrogation_Position=643; Antisense; GATCATCTTGACACTGGGACACTCG
>probe:Drosophila_2:1630395_at:425:323; Interrogation_Position=667; Antisense; GCGCAGCGTCGAGAATTTCCTCAAA
>probe:Drosophila_2:1630395_at:47:183; Interrogation_Position=702; Antisense; AAAAGCGTCAGTTTCTCACCATCAT
>probe:Drosophila_2:1630395_at:168:37; Interrogation_Position=722; Antisense; ATCATCGTAGCCGAATGTGCGCCAG
>probe:Drosophila_2:1630395_at:170:727; Interrogation_Position=801; Antisense; TTGTTGTGATCCCAGATGCGGCCAT
>probe:Drosophila_2:1630395_at:554:633; Interrogation_Position=828; Antisense; TCGCTATGATGTCGCGCGTCAACAA
>probe:Drosophila_2:1630395_at:585:121; Interrogation_Position=872; Antisense; AGCGTGCTGGCTAATGGAGGACTCA
>probe:Drosophila_2:1630395_at:243:587; Interrogation_Position=907; Antisense; TGGAGCGTATACAGTGGCCCTGGCC
>probe:Drosophila_2:1630395_at:173:61; Interrogation_Position=971; Antisense; ATGTACAAACTCTCACCATTGCATC

Paste this into a BLAST search page for me
GGACGCCTTCAATATGGTCGGCTGTGGATGTGATACCCTACGATTCGATTATTCCAGCGCGCGAAGCCAAGGTATATACAGTCCCATGTTCGACTACGTGAGGAGCACATCCATTCGTCGGAGATGATCATCTTGACACTGGGACACTCGGCGCAGCGTCGAGAATTTCCTCAAAAAAAGCGTCAGTTTCTCACCATCATATCATCGTAGCCGAATGTGCGCCAGTTGTTGTGATCCCAGATGCGGCCATTCGCTATGATGTCGCGCGTCAACAAAGCGTGCTGGCTAATGGAGGACTCATGGAGCGTATACAGTGGCCCTGGCCATGTACAAACTCTCACCATTGCATC

Full Affymetrix probeset data:

Annotations for 1630395_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720