Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630396_at:

>probe:Drosophila_2:1630396_at:657:619; Interrogation_Position=2152; Antisense; TGCTAGACCCACTTCAGATCCAGAT
>probe:Drosophila_2:1630396_at:334:261; Interrogation_Position=2209; Antisense; CAGCCAGTCAAGCAGCCATTGAGGA
>probe:Drosophila_2:1630396_at:260:685; Interrogation_Position=2269; Antisense; TATAGATCGCATATACGGCATACGA
>probe:Drosophila_2:1630396_at:397:221; Interrogation_Position=2333; Antisense; AAGTGTTATTTACCTGCTGTGCAGA
>probe:Drosophila_2:1630396_at:697:509; Interrogation_Position=2351; Antisense; GTGCAGAGCGCAATTGTATGTAACT
>probe:Drosophila_2:1630396_at:450:687; Interrogation_Position=2375; Antisense; TATATCGTAGAGAGCTGATCCACAT
>probe:Drosophila_2:1630396_at:585:447; Interrogation_Position=2391; Antisense; GATCCACATGCGTGTCCAATTGTAA
>probe:Drosophila_2:1630396_at:125:341; Interrogation_Position=2422; Antisense; GCTAGCCGTGTTGGCATAAGCCACA
>probe:Drosophila_2:1630396_at:26:65; Interrogation_Position=2469; Antisense; AGGCCTAAACTCTATACTATCCCAT
>probe:Drosophila_2:1630396_at:545:45; Interrogation_Position=2487; Antisense; ATCCCATGATGGTTCGATTTGAGTC
>probe:Drosophila_2:1630396_at:127:673; Interrogation_Position=2578; Antisense; TACCCATCAATTTCTCGCTTTTCAA
>probe:Drosophila_2:1630396_at:649:365; Interrogation_Position=2615; Antisense; GAATCATCGGCGTCTTTTTAAGTTT
>probe:Drosophila_2:1630396_at:715:215; Interrogation_Position=2634; Antisense; AAGTTTGGTTGCTGTTTTCGAATGG
>probe:Drosophila_2:1630396_at:529:703; Interrogation_Position=2682; Antisense; TTAGATGTGACCTACTTTGCACAAT

Paste this into a BLAST search page for me
TGCTAGACCCACTTCAGATCCAGATCAGCCAGTCAAGCAGCCATTGAGGATATAGATCGCATATACGGCATACGAAAGTGTTATTTACCTGCTGTGCAGAGTGCAGAGCGCAATTGTATGTAACTTATATCGTAGAGAGCTGATCCACATGATCCACATGCGTGTCCAATTGTAAGCTAGCCGTGTTGGCATAAGCCACAAGGCCTAAACTCTATACTATCCCATATCCCATGATGGTTCGATTTGAGTCTACCCATCAATTTCTCGCTTTTCAAGAATCATCGGCGTCTTTTTAAGTTTAAGTTTGGTTGCTGTTTTCGAATGGTTAGATGTGACCTACTTTGCACAAT

Full Affymetrix probeset data:

Annotations for 1630396_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime