FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630397_at:

>probe:Drosophila_2:1630397_at:425:503; Interrogation_Position=1484; Antisense; GTCCAGCGAAATTTCCGGTCGTGAT
>probe:Drosophila_2:1630397_at:107:509; Interrogation_Position=1515; Antisense; GTGCAGGTGCGCAGTACTCGCAGAA
>probe:Drosophila_2:1630397_at:290:427; Interrogation_Position=1555; Antisense; GAGATGCCGCCAATGAGGATCCCGC
>probe:Drosophila_2:1630397_at:55:27; Interrogation_Position=1656; Antisense; ATAGAAGATCACAAGTCCCGCCTGG
>probe:Drosophila_2:1630397_at:121:427; Interrogation_Position=1683; Antisense; GAGATGGTCCATGAGGCCTCCAAAC
>probe:Drosophila_2:1630397_at:668:451; Interrogation_Position=1734; Antisense; GATCTGGACAGGCATCTGCGCGAAC
>probe:Drosophila_2:1630397_at:429:317; Interrogation_Position=1767; Antisense; GCCGACGACCCGATGCTGGAGTACA
>probe:Drosophila_2:1630397_at:178:183; Interrogation_Position=1827; Antisense; AACAAGCCGGTGATGCCCAAGTACG
>probe:Drosophila_2:1630397_at:4:553; Interrogation_Position=1854; Antisense; GGCAGCTTTCCGGAGAACCGATTTG
>probe:Drosophila_2:1630397_at:424:201; Interrogation_Position=1869; Antisense; AACCGATTTGGCATCCGACCAGGAT
>probe:Drosophila_2:1630397_at:39:69; Interrogation_Position=1903; Antisense; ATGGCGTCGATCGATCCAACGGCTA
>probe:Drosophila_2:1630397_at:181:341; Interrogation_Position=1924; Antisense; GCTACGAGCAGCGTTGGTTCGACAA
>probe:Drosophila_2:1630397_at:23:445; Interrogation_Position=1974; Antisense; GATGAGGCCTACAAGTACAGCGTGG
>probe:Drosophila_2:1630397_at:59:123; Interrogation_Position=2018; Antisense; AGCGTTGTTTGCTTTCGTGTTGCAA

Paste this into a BLAST search page for me
GTCCAGCGAAATTTCCGGTCGTGATGTGCAGGTGCGCAGTACTCGCAGAAGAGATGCCGCCAATGAGGATCCCGCATAGAAGATCACAAGTCCCGCCTGGGAGATGGTCCATGAGGCCTCCAAACGATCTGGACAGGCATCTGCGCGAACGCCGACGACCCGATGCTGGAGTACAAACAAGCCGGTGATGCCCAAGTACGGGCAGCTTTCCGGAGAACCGATTTGAACCGATTTGGCATCCGACCAGGATATGGCGTCGATCGATCCAACGGCTAGCTACGAGCAGCGTTGGTTCGACAAGATGAGGCCTACAAGTACAGCGTGGAGCGTTGTTTGCTTTCGTGTTGCAA

Full Affymetrix probeset data:

Annotations for 1630397_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720