FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630398_at:

>probe:Drosophila_2:1630398_at:536:69; Interrogation_Position=468; Antisense; ATGGCCACGCCTACTGGAAAGGTTT
>probe:Drosophila_2:1630398_at:425:523; Interrogation_Position=523; Antisense; GGGCCATCACTGAGATCATCCGATA
>probe:Drosophila_2:1630398_at:659:189; Interrogation_Position=564; Antisense; AACATCGTCAAGGTGGTGCCGCATT
>probe:Drosophila_2:1630398_at:514:273; Interrogation_Position=585; Antisense; CATTTTGTGGTGTTCCTGCGCTACA
>probe:Drosophila_2:1630398_at:560:339; Interrogation_Position=604; Antisense; GCTACACCACATTCATTGTCCTGTA
>probe:Drosophila_2:1630398_at:390:5; Interrogation_Position=618; Antisense; ATTGTCCTGTATCCCATCGGCGTGA
>probe:Drosophila_2:1630398_at:445:117; Interrogation_Position=675; Antisense; AGCTATGCCCGTGAGAACAGCGTGT
>probe:Drosophila_2:1630398_at:540:261; Interrogation_Position=731; Antisense; CACCTTCTCGTATTTTGGATTCCTG
>probe:Drosophila_2:1630398_at:336:595; Interrogation_Position=754; Antisense; TGTGGATCGTCATGCTCGGCTACAT
>probe:Drosophila_2:1630398_at:393:349; Interrogation_Position=791; Antisense; GCAGTTGTACTTGCACATGTTCGCC
>probe:Drosophila_2:1630398_at:195:381; Interrogation_Position=874; Antisense; GAACCTTGACCAGCGGCGAATGCAA
>probe:Drosophila_2:1630398_at:5:21; Interrogation_Position=910; Antisense; ATTTGCATATCATTGGCCGTCGCAC
>probe:Drosophila_2:1630398_at:275:355; Interrogation_Position=931; Antisense; GCACTTTGAGCCGTTTTCGCTTTTT
>probe:Drosophila_2:1630398_at:32:667; Interrogation_Position=979; Antisense; TACACAAGCACATTCGTTCGGACTA

Paste this into a BLAST search page for me
ATGGCCACGCCTACTGGAAAGGTTTGGGCCATCACTGAGATCATCCGATAAACATCGTCAAGGTGGTGCCGCATTCATTTTGTGGTGTTCCTGCGCTACAGCTACACCACATTCATTGTCCTGTAATTGTCCTGTATCCCATCGGCGTGAAGCTATGCCCGTGAGAACAGCGTGTCACCTTCTCGTATTTTGGATTCCTGTGTGGATCGTCATGCTCGGCTACATGCAGTTGTACTTGCACATGTTCGCCGAACCTTGACCAGCGGCGAATGCAAATTTGCATATCATTGGCCGTCGCACGCACTTTGAGCCGTTTTCGCTTTTTTACACAAGCACATTCGTTCGGACTA

Full Affymetrix probeset data:

Annotations for 1630398_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720