Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630399_at:

>probe:Drosophila_2:1630399_at:619:639; Interrogation_Position=4929; Antisense; TCGGAATGGCCAGCTCAACAATCGC
>probe:Drosophila_2:1630399_at:291:601; Interrogation_Position=4955; Antisense; TGTACGGCGGAGAGGTGCCCATCAC
>probe:Drosophila_2:1630399_at:679:253; Interrogation_Position=4980; Antisense; CAACCCGCTGTTTCAAAGATCCAAT
>probe:Drosophila_2:1630399_at:124:203; Interrogation_Position=5014; Antisense; AACCACCTGAGCAGCACCAATGAGA
>probe:Drosophila_2:1630399_at:504:247; Interrogation_Position=5031; Antisense; CAATGAGAACGTGTCCTTCGGGAAG
>probe:Drosophila_2:1630399_at:123:405; Interrogation_Position=5059; Antisense; GACTATGGCCAAATAGGGTTCTCAT
>probe:Drosophila_2:1630399_at:653:529; Interrogation_Position=5074; Antisense; GGGTTCTCATATCTAAACGATCTGG
>probe:Drosophila_2:1630399_at:189:565; Interrogation_Position=5145; Antisense; GGAATATTCTGGTTTCGATACATTT
>probe:Drosophila_2:1630399_at:566:401; Interrogation_Position=5174; Antisense; GACTTGTTAATATACTTAGCTGCCA
>probe:Drosophila_2:1630399_at:494:135; Interrogation_Position=5228; Antisense; ACGAGAGCGGTTGCCATCAATTTAT
>probe:Drosophila_2:1630399_at:44:355; Interrogation_Position=5260; Antisense; GCACGAGCAATCTGTAAATACCTGA
>probe:Drosophila_2:1630399_at:20:383; Interrogation_Position=5368; Antisense; GAACGCAGAGTGCATACTTCCCACA
>probe:Drosophila_2:1630399_at:434:157; Interrogation_Position=5390; Antisense; ACACACTTACGAAACTGCCAGACGC
>probe:Drosophila_2:1630399_at:261:87; Interrogation_Position=5409; Antisense; AGACGCAGTCGTTTTCTTTAGGAAT

Paste this into a BLAST search page for me
TCGGAATGGCCAGCTCAACAATCGCTGTACGGCGGAGAGGTGCCCATCACCAACCCGCTGTTTCAAAGATCCAATAACCACCTGAGCAGCACCAATGAGACAATGAGAACGTGTCCTTCGGGAAGGACTATGGCCAAATAGGGTTCTCATGGGTTCTCATATCTAAACGATCTGGGGAATATTCTGGTTTCGATACATTTGACTTGTTAATATACTTAGCTGCCAACGAGAGCGGTTGCCATCAATTTATGCACGAGCAATCTGTAAATACCTGAGAACGCAGAGTGCATACTTCCCACAACACACTTACGAAACTGCCAGACGCAGACGCAGTCGTTTTCTTTAGGAAT

Full Affymetrix probeset data:

Annotations for 1630399_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime