Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630400_at:

>probe:Drosophila_2:1630400_at:231:351; Interrogation_Position=1948; Antisense; GCAGTATCCGTCGAGTGTGGCCAGT
>probe:Drosophila_2:1630400_at:509:519; Interrogation_Position=1995; Antisense; GGGCGAGAACTCAACCGAGGGTATT
>probe:Drosophila_2:1630400_at:171:3; Interrogation_Position=2017; Antisense; ATTGGACCGTCGATTAGCACCACAT
>probe:Drosophila_2:1630400_at:176:555; Interrogation_Position=2083; Antisense; GGAGCCATCCTACTGCTACGCAGAG
>probe:Drosophila_2:1630400_at:376:265; Interrogation_Position=2103; Antisense; CAGAGCCCATGTACAATGCCAACTA
>probe:Drosophila_2:1630400_at:503:667; Interrogation_Position=2129; Antisense; TACTACGAAAGTGCTGGTGGCGCCC
>probe:Drosophila_2:1630400_at:14:709; Interrogation_Position=2171; Antisense; TTACTACCCACTGCTGCGGACTATA
>probe:Drosophila_2:1630400_at:228:527; Interrogation_Position=2208; Antisense; GGGACTCCAGTTTTGGATCCGATTC
>probe:Drosophila_2:1630400_at:330:631; Interrogation_Position=2225; Antisense; TCCGATTCGGGATACAGCCACCATA
>probe:Drosophila_2:1630400_at:684:627; Interrogation_Position=2254; Antisense; TGCCAGCTCGATTGGGCGACAGGAC
>probe:Drosophila_2:1630400_at:90:75; Interrogation_Position=2274; Antisense; AGGACTATGACGTAGCCGAGCCACA
>probe:Drosophila_2:1630400_at:149:703; Interrogation_Position=2328; Antisense; TTAGTTCCGCCCTAAACTTCAGTTG
>probe:Drosophila_2:1630400_at:104:467; Interrogation_Position=2349; Antisense; GTTGGAATCGCAACTCGCGGAGCAA
>probe:Drosophila_2:1630400_at:385:213; Interrogation_Position=2399; Antisense; AAGACCTCGGGAAATAGCAGCAACA

Paste this into a BLAST search page for me
GCAGTATCCGTCGAGTGTGGCCAGTGGGCGAGAACTCAACCGAGGGTATTATTGGACCGTCGATTAGCACCACATGGAGCCATCCTACTGCTACGCAGAGCAGAGCCCATGTACAATGCCAACTATACTACGAAAGTGCTGGTGGCGCCCTTACTACCCACTGCTGCGGACTATAGGGACTCCAGTTTTGGATCCGATTCTCCGATTCGGGATACAGCCACCATATGCCAGCTCGATTGGGCGACAGGACAGGACTATGACGTAGCCGAGCCACATTAGTTCCGCCCTAAACTTCAGTTGGTTGGAATCGCAACTCGCGGAGCAAAAGACCTCGGGAAATAGCAGCAACA

Full Affymetrix probeset data:

Annotations for 1630400_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime