Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630402_at:

>probe:Drosophila_2:1630402_at:408:17; Interrogation_Position=3564; Antisense; ATTTACACCTGACAGTGCACAACTG
>probe:Drosophila_2:1630402_at:445:175; Interrogation_Position=3605; Antisense; AAACGTGTAACTATGAGAGCCTTCA
>probe:Drosophila_2:1630402_at:267:609; Interrogation_Position=3618; Antisense; TGAGAGCCTTCAACTTTCATAAGTT
>probe:Drosophila_2:1630402_at:244:433; Interrogation_Position=3659; Antisense; GAGGAACCATAATTTGTAACCACAA
>probe:Drosophila_2:1630402_at:624:603; Interrogation_Position=3695; Antisense; TGTTGCAGCAGCATACAGGCCGTAT
>probe:Drosophila_2:1630402_at:705:267; Interrogation_Position=3710; Antisense; CAGGCCGTATACTTAATTTTGTTAT
>probe:Drosophila_2:1630402_at:302:243; Interrogation_Position=3749; Antisense; AATATTTCTCGCTGAACATGGCCTC
>probe:Drosophila_2:1630402_at:432:187; Interrogation_Position=3763; Antisense; AACATGGCCTCGCATATTGTAGCTC
>probe:Drosophila_2:1630402_at:714:485; Interrogation_Position=3781; Antisense; GTAGCTCGCCATTTTGTTTCATTTG
>probe:Drosophila_2:1630402_at:470:479; Interrogation_Position=3796; Antisense; GTTTCATTTGTTTTCTTCTGAGAGC
>probe:Drosophila_2:1630402_at:264:425; Interrogation_Position=3815; Antisense; GAGAGCGATTTCTGTACCGCTCGCT
>probe:Drosophila_2:1630402_at:75:133; Interrogation_Position=3830; Antisense; ACCGCTCGCTGTTGTTTTTGTTATC
>probe:Drosophila_2:1630402_at:702:663; Interrogation_Position=3907; Antisense; TAAAGCCTACCAATCTAAACGCAAT
>probe:Drosophila_2:1630402_at:517:355; Interrogation_Position=4046; Antisense; GCACTTTTGTAAACATAGCTCCCGA

Paste this into a BLAST search page for me
ATTTACACCTGACAGTGCACAACTGAAACGTGTAACTATGAGAGCCTTCATGAGAGCCTTCAACTTTCATAAGTTGAGGAACCATAATTTGTAACCACAATGTTGCAGCAGCATACAGGCCGTATCAGGCCGTATACTTAATTTTGTTATAATATTTCTCGCTGAACATGGCCTCAACATGGCCTCGCATATTGTAGCTCGTAGCTCGCCATTTTGTTTCATTTGGTTTCATTTGTTTTCTTCTGAGAGCGAGAGCGATTTCTGTACCGCTCGCTACCGCTCGCTGTTGTTTTTGTTATCTAAAGCCTACCAATCTAAACGCAATGCACTTTTGTAAACATAGCTCCCGA

Full Affymetrix probeset data:

Annotations for 1630402_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime