Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630403_s_at:

>probe:Drosophila_2:1630403_s_at:533:425; Interrogation_Position=1029; Antisense; GAGAGGGAAGCCAGTACCAGCGACT
>probe:Drosophila_2:1630403_s_at:275:425; Interrogation_Position=1117; Antisense; GAGACCTCTGCTCGCTGACAAGGAG
>probe:Drosophila_2:1630403_s_at:414:631; Interrogation_Position=642; Antisense; TCCTCGTCATTACCTTCTTCAAGTT
>probe:Drosophila_2:1630403_s_at:236:417; Interrogation_Position=707; Antisense; GAGCTGTGGCTATACAAGAACCCAA
>probe:Drosophila_2:1630403_s_at:686:105; Interrogation_Position=723; Antisense; AGAACCCAAGGCGACCGGACATTGT
>probe:Drosophila_2:1630403_s_at:422:283; Interrogation_Position=761; Antisense; CTGCTCTTCTGGGTGATAGTGGCTC
>probe:Drosophila_2:1630403_s_at:559:23; Interrogation_Position=776; Antisense; ATAGTGGCTCCCTTTCTGGTCACTA
>probe:Drosophila_2:1630403_s_at:23:683; Interrogation_Position=799; Antisense; TATCGCCTTCTACTGGTACACAAGA
>probe:Drosophila_2:1630403_s_at:269:619; Interrogation_Position=836; Antisense; TGCATCGCTGTGATACCTCTGTTTA
>probe:Drosophila_2:1630403_s_at:601:27; Interrogation_Position=848; Antisense; ATACCTCTGTTTATCGCACTGCTGG
>probe:Drosophila_2:1630403_s_at:237:621; Interrogation_Position=867; Antisense; TGCTGGTTGCAGTTAGTCGCACCTG
>probe:Drosophila_2:1630403_s_at:301:129; Interrogation_Position=900; Antisense; ACCACCACTGGCAGGATGTGACCAT
>probe:Drosophila_2:1630403_s_at:318:659; Interrogation_Position=957; Antisense; TAAGCTACACACAATACTATCCCTC
>probe:Drosophila_2:1630403_s_at:107:607; Interrogation_Position=994; Antisense; TGATGCCGGCATACCACTGGTCAGG

Paste this into a BLAST search page for me
GAGAGGGAAGCCAGTACCAGCGACTGAGACCTCTGCTCGCTGACAAGGAGTCCTCGTCATTACCTTCTTCAAGTTGAGCTGTGGCTATACAAGAACCCAAAGAACCCAAGGCGACCGGACATTGTCTGCTCTTCTGGGTGATAGTGGCTCATAGTGGCTCCCTTTCTGGTCACTATATCGCCTTCTACTGGTACACAAGATGCATCGCTGTGATACCTCTGTTTAATACCTCTGTTTATCGCACTGCTGGTGCTGGTTGCAGTTAGTCGCACCTGACCACCACTGGCAGGATGTGACCATTAAGCTACACACAATACTATCCCTCTGATGCCGGCATACCACTGGTCAGG

Full Affymetrix probeset data:

Annotations for 1630403_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime